ID: 1099658714

View in Genome Browser
Species Human (GRCh38)
Location 12:85527851-85527873
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658706_1099658714 6 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658708_1099658714 5 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658709_1099658714 4 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658710_1099658714 3 Left 1099658710 12:85527825-85527847 CCACACAGAGCCCTCACTGGAGC No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658712_1099658714 -8 Left 1099658712 12:85527836-85527858 CCTCACTGGAGCATTGTCTAGTG No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658711_1099658714 -7 Left 1099658711 12:85527835-85527857 CCCTCACTGGAGCATTGTCTAGT No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data
1099658705_1099658714 30 Left 1099658705 12:85527798-85527820 CCAAGGGGAAATGTGGGGTTAGA No data
Right 1099658714 12:85527851-85527873 GTCTAGTGGAGCTGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658714 Original CRISPR GTCTAGTGGAGCTGTGAGAA AGG Intergenic