ID: 1099658716

View in Genome Browser
Species Human (GRCh38)
Location 12:85527853-85527875
Sequence CTAGTGGAGCTGTGAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658711_1099658716 -5 Left 1099658711 12:85527835-85527857 CCCTCACTGGAGCATTGTCTAGT No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658706_1099658716 8 Left 1099658706 12:85527822-85527844 CCCCCACACAGAGCCCTCACTGG No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658712_1099658716 -6 Left 1099658712 12:85527836-85527858 CCTCACTGGAGCATTGTCTAGTG No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658709_1099658716 6 Left 1099658709 12:85527824-85527846 CCCACACAGAGCCCTCACTGGAG No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658710_1099658716 5 Left 1099658710 12:85527825-85527847 CCACACAGAGCCCTCACTGGAGC No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data
1099658708_1099658716 7 Left 1099658708 12:85527823-85527845 CCCCACACAGAGCCCTCACTGGA No data
Right 1099658716 12:85527853-85527875 CTAGTGGAGCTGTGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658716 Original CRISPR CTAGTGGAGCTGTGAGAAAG GGG Intergenic