ID: 1099658719

View in Genome Browser
Species Human (GRCh38)
Location 12:85527879-85527901
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099658712_1099658719 20 Left 1099658712 12:85527836-85527858 CCTCACTGGAGCATTGTCTAGTG No data
Right 1099658719 12:85527879-85527901 CCACCCTCCAGATGTGAGAATGG No data
1099658711_1099658719 21 Left 1099658711 12:85527835-85527857 CCCTCACTGGAGCATTGTCTAGT No data
Right 1099658719 12:85527879-85527901 CCACCCTCCAGATGTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099658719 Original CRISPR CCACCCTCCAGATGTGAGAA TGG Intergenic
No off target data available for this crispr