ID: 1099662464

View in Genome Browser
Species Human (GRCh38)
Location 12:85581875-85581897
Sequence ATGTGTAAGTGAAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099662464_1099662469 23 Left 1099662464 12:85581875-85581897 CCTTCCCCCTTTCACTTACACAT No data
Right 1099662469 12:85581921-85581943 TGTAAAATCTGTTAAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099662464 Original CRISPR ATGTGTAAGTGAAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr