ID: 1099670476

View in Genome Browser
Species Human (GRCh38)
Location 12:85685483-85685505
Sequence CAGTTTTGAACCACTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099670476_1099670478 27 Left 1099670476 12:85685483-85685505 CCAATCTCAGTGGTTCAAAACTG No data
Right 1099670478 12:85685533-85685555 AATGACAAAATTATAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099670476 Original CRISPR CAGTTTTGAACCACTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr