ID: 1099671007

View in Genome Browser
Species Human (GRCh38)
Location 12:85692658-85692680
Sequence TCACACACTTCTGGCACTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099671004_1099671007 -10 Left 1099671004 12:85692645-85692667 CCTTGTTTCTCTTTCACACACTT No data
Right 1099671007 12:85692658-85692680 TCACACACTTCTGGCACTAAGGG No data
1099671003_1099671007 26 Left 1099671003 12:85692609-85692631 CCACATAGTTCTAGTTCTGGTTC No data
Right 1099671007 12:85692658-85692680 TCACACACTTCTGGCACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099671007 Original CRISPR TCACACACTTCTGGCACTAA GGG Intergenic
No off target data available for this crispr