ID: 1099673067

View in Genome Browser
Species Human (GRCh38)
Location 12:85719095-85719117
Sequence CTAGATTCCCAGGAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099673064_1099673067 -2 Left 1099673064 12:85719074-85719096 CCTCATACACGCATGTTCCTTCT No data
Right 1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG No data
1099673063_1099673067 15 Left 1099673063 12:85719057-85719079 CCTGGGTGCATAAACAACCTCAT No data
Right 1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG No data
1099673062_1099673067 30 Left 1099673062 12:85719042-85719064 CCTTCTCAGATATTTCCTGGGTG No data
Right 1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099673067 Original CRISPR CTAGATTCCCAGGAATATAT TGG Intergenic
No off target data available for this crispr