ID: 1099673473

View in Genome Browser
Species Human (GRCh38)
Location 12:85726202-85726224
Sequence TGGTTGTCACAGATGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099673473_1099673479 11 Left 1099673473 12:85726202-85726224 CCTTACCCCATCTGTGACAACCA No data
Right 1099673479 12:85726236-85726258 AGACACTGCCAAATGTTCTCTGG No data
1099673473_1099673480 14 Left 1099673473 12:85726202-85726224 CCTTACCCCATCTGTGACAACCA No data
Right 1099673480 12:85726239-85726261 CACTGCCAAATGTTCTCTGGAGG No data
1099673473_1099673481 15 Left 1099673473 12:85726202-85726224 CCTTACCCCATCTGTGACAACCA No data
Right 1099673481 12:85726240-85726262 ACTGCCAAATGTTCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099673473 Original CRISPR TGGTTGTCACAGATGGGGTA AGG (reversed) Intergenic
No off target data available for this crispr