ID: 1099673649

View in Genome Browser
Species Human (GRCh38)
Location 12:85728681-85728703
Sequence GAGAACAGCCGGCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099673649_1099673655 30 Left 1099673649 12:85728681-85728703 CCTGGAGCCTGCCGGCTGTTCTC No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099673649 Original CRISPR GAGAACAGCCGGCAGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr