ID: 1099673655

View in Genome Browser
Species Human (GRCh38)
Location 12:85728734-85728756
Sequence GCTTCTCCAACATAGTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099673649_1099673655 30 Left 1099673649 12:85728681-85728703 CCTGGAGCCTGCCGGCTGTTCTC No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data
1099673652_1099673655 -3 Left 1099673652 12:85728714-85728736 CCCAGTTTCTTGCCTTGTGAGCT No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data
1099673653_1099673655 -4 Left 1099673653 12:85728715-85728737 CCAGTTTCTTGCCTTGTGAGCTT No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data
1099673651_1099673655 19 Left 1099673651 12:85728692-85728714 CCGGCTGTTCTCAAAGTCTACTC No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data
1099673650_1099673655 23 Left 1099673650 12:85728688-85728710 CCTGCCGGCTGTTCTCAAAGTCT No data
Right 1099673655 12:85728734-85728756 GCTTCTCCAACATAGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099673655 Original CRISPR GCTTCTCCAACATAGTTTCA AGG Intergenic
No off target data available for this crispr