ID: 1099674012

View in Genome Browser
Species Human (GRCh38)
Location 12:85733325-85733347
Sequence CCTGAGAAGCGGCTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099674012_1099674018 -6 Left 1099674012 12:85733325-85733347 CCTTGCACCAGCCGCTTCTCAGG No data
Right 1099674018 12:85733342-85733364 CTCAGGGGCTCTCAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099674012 Original CRISPR CCTGAGAAGCGGCTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr