ID: 1099689781

View in Genome Browser
Species Human (GRCh38)
Location 12:85938048-85938070
Sequence GACAGCTCTTTGTCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099689777_1099689781 16 Left 1099689777 12:85938009-85938031 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG No data
1099689778_1099689781 15 Left 1099689778 12:85938010-85938032 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG No data
1099689779_1099689781 11 Left 1099689779 12:85938014-85938036 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099689781 Original CRISPR GACAGCTCTTTGTCTGTTAC TGG Intergenic
No off target data available for this crispr