ID: 1099691625

View in Genome Browser
Species Human (GRCh38)
Location 12:85961074-85961096
Sequence CCAATTTGTAATTCTTGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099691625 Original CRISPR CCAATTTGTAATTCTTGCCC TGG (reversed) Exonic
901155746 1:7136952-7136974 CAAATGTGTAATTCTAGCCCTGG + Intronic
905249860 1:36641160-36641182 CCAAGTTCTATTTCTTGACCTGG - Intergenic
905993244 1:42358402-42358424 CCAATATCTAACTCTTGCCTAGG - Intergenic
906558870 1:46738988-46739010 CCAATTAATAATTCTAGGCCAGG - Intergenic
909042263 1:70668706-70668728 CAAATTTTTAATTCTGGCACTGG + Intergenic
915182962 1:154079091-154079113 CTAATTTTTATTTTTTGCCCAGG - Intronic
915963650 1:160287632-160287654 ACAAATTCTAATTCTTGCCTGGG + Intergenic
917232366 1:172852047-172852069 CCAATTCGTAATTCATGCAGTGG - Intergenic
921260765 1:213383481-213383503 CGGATATGAAATTCTTGCCCTGG - Intergenic
1067794694 10:49312272-49312294 CCATTTTTAAATTCCTGCCCAGG + Intronic
1068568144 10:58598206-58598228 CAGATTTGTTCTTCTTGCCCAGG - Intronic
1070775312 10:79106414-79106436 CCAATTGGTAATGCCTGCCATGG + Intronic
1071267238 10:83975144-83975166 CCAATTATTAATTCTGGCACTGG + Intergenic
1072976644 10:100064674-100064696 TAAATTTGTAATTATTGGCCTGG - Intronic
1078280158 11:9893191-9893213 CTAATTTGCAATTTGTGCCCAGG + Intronic
1078612564 11:12834134-12834156 CCAAATTATAATTATTCCCCAGG - Intronic
1080092729 11:28367647-28367669 CAACTTTGTTCTTCTTGCCCAGG - Intergenic
1087712046 11:101566176-101566198 TCACTTTGTAAGTTTTGCCCAGG + Intronic
1088177011 11:107065050-107065072 CCTGTTTGTACTTTTTGCCCTGG - Intergenic
1090055737 11:123422906-123422928 CCAAATTGTAGTTCTTGGACTGG + Intergenic
1092281914 12:7104161-7104183 CCAATTTTTAAAACTTCCCCTGG - Intronic
1094308787 12:29053747-29053769 CCATTTTGTAATTATTTCCCTGG - Intergenic
1099691625 12:85961074-85961096 CCAATTTGTAATTCTTGCCCTGG - Exonic
1100146813 12:91688498-91688520 ACAATATGCAATTCTAGCCCAGG - Intergenic
1101039598 12:100741226-100741248 CCAATGTGTAATTCTGGTTCTGG + Intronic
1103966704 12:124644602-124644624 CCATGTTCTACTTCTTGCCCTGG + Intergenic
1106120071 13:26852727-26852749 TCAATTTGTAGTTCTCGCCTCGG + Intergenic
1106587696 13:31071717-31071739 CAAATTTGTATCTCTAGCCCAGG + Intergenic
1107353991 13:39546338-39546360 CCAATTTGTAGGCATTGCCCAGG - Intronic
1107516725 13:41136556-41136578 TCTATTTCTAAATCTTGCCCAGG - Intergenic
1107847871 13:44536248-44536270 TCAATTTTTACTTCTTGCCTAGG + Intronic
1108540199 13:51435957-51435979 GAAATTTGTAATTCTGGCCTTGG - Intronic
1108562845 13:51663581-51663603 CAAATCTTAAATTCTTGCCCAGG - Intronic
1108624779 13:52217269-52217291 CAGCTTTGTACTTCTTGCCCAGG - Intergenic
1108661271 13:52589149-52589171 CAGCTTTGTACTTCTTGCCCAGG + Intergenic
1109473135 13:62837981-62838003 CCAATTTAGAATTCCTGCCGGGG - Intergenic
1110012903 13:70361616-70361638 CCAATTTGAAATTTTTATCCAGG - Intergenic
1113150192 13:107254618-107254640 CCCACTTGTAAGCCTTGCCCTGG + Intronic
1115648125 14:35384261-35384283 CCAATTGGTTGTTCTTGCCTAGG + Intergenic
1116710688 14:48364403-48364425 CCAAGTTGCAATTCTGCCCCAGG - Intergenic
1118900111 14:69979381-69979403 CCACTTTCTCATTTTTGCCCAGG - Intronic
1119929452 14:78530685-78530707 TGCTTTTGTAATTCTTGCCCTGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123789968 15:23710537-23710559 TCAATTTGTCAATCTTTCCCTGG + Intergenic
1125167961 15:36731810-36731832 CCAAATTGTATTTCTTTCCCAGG + Intronic
1125264124 15:37860081-37860103 CCAATTAGTGATTCTTAACCAGG - Intergenic
1126553972 15:49965823-49965845 CCTATTTGTCCATCTTGCCCAGG - Intronic
1135041139 16:19117577-19117599 CCAATTTGTAACACTTGGACTGG - Exonic
1137844375 16:51672938-51672960 CGACTTTCTACTTCTTGCCCTGG - Intergenic
1140299501 16:73742501-73742523 GCAATTTGGAATATTTGCCCTGG - Intergenic
1140940449 16:79717204-79717226 CCTATTTATAATACTTGCCACGG - Intergenic
1141685898 16:85569864-85569886 CCCATTTGTAATACAAGCCCTGG + Intergenic
1144358285 17:14467036-14467058 TTAATTTATAATTTTTGCCCAGG + Intergenic
1145247626 17:21280004-21280026 CCAAGTTCTAAGTCCTGCCCTGG - Intergenic
1146050246 17:29544929-29544951 CCAAATTTTAAGTCTTTCCCAGG + Exonic
1146085833 17:29828611-29828633 GCAATATGTAATTCTAGGCCTGG - Intronic
1147136217 17:38435530-38435552 GCTGTTTGTACTTCTTGCCCTGG + Intronic
1148376198 17:47148782-47148804 TCAATTAGAAATTCTTGGCCAGG + Intronic
1151010622 17:70490830-70490852 CCAATATATAAATCTTGTCCAGG - Intergenic
1153095521 18:1397577-1397599 CCCCTTTGTTATTTTTGCCCGGG + Intergenic
1153116772 18:1666711-1666733 CCTTTTTGTAATCCTTTCCCAGG + Intergenic
1153963358 18:10158831-10158853 CCACTTTGGAATTCTTCCTCTGG + Intergenic
1157723791 18:49946964-49946986 ATAATTTGTATTTCTTGCCTGGG - Intronic
1159201221 18:65187484-65187506 AGAATTTGTAATTTTTGCCATGG - Intergenic
1160656410 19:273638-273660 ACAATATGTATTTCTTGGCCAGG - Intergenic
1162121004 19:8468536-8468558 CCTACTTGGACTTCTTGCCCAGG + Intronic
1162835171 19:13312073-13312095 CCATCTTGTAGTTTTTGCCCTGG + Intronic
1162835388 19:13313608-13313630 CCATCTTGTAGTTTTTGCCCTGG + Intronic
1166678760 19:44754910-44754932 CCAATTTGCAACTCTGGCCCCGG + Intronic
1167602755 19:50464281-50464303 CCATTTTGTCATCATTGCCCAGG + Intronic
925462117 2:4072572-4072594 TCAAATTGTAATTCCTGGCCGGG + Intergenic
926116035 2:10214064-10214086 CCATTTTGTTCTTGTTGCCCAGG - Intergenic
926366233 2:12135553-12135575 CAGATTTGTTCTTCTTGCCCAGG + Intergenic
926590390 2:14734398-14734420 CCCATGTAGAATTCTTGCCCAGG + Intergenic
927231239 2:20826122-20826144 CCAATCAGAAATTCTTCCCCGGG - Intergenic
928286294 2:29992807-29992829 CAAATTTGTAATTCTAGGGCTGG - Intergenic
932187097 2:69707382-69707404 CAATTTTGTATTTCTTGACCTGG - Intronic
938144635 2:128823391-128823413 CCTATTTGTCCATCTTGCCCAGG - Intergenic
939525081 2:143283076-143283098 ACAATTTGTGATTTTTCCCCAGG + Intronic
940001624 2:148972273-148972295 CCATTTTGTAAAAATTGCCCAGG - Intronic
940185784 2:150983815-150983837 CCAAGTTGTATTTCTTGGCCTGG + Intergenic
942013525 2:171788696-171788718 CCAAATTGAATTTCTTCCCCCGG - Intronic
942396337 2:175553688-175553710 CCAATTTGTTTTTCCTGCCTTGG - Intergenic
942496856 2:176549122-176549144 CAAATTTATATTTCCTGCCCAGG + Intergenic
943129858 2:183841542-183841564 CCTATTTGGCAATCTTGCCCAGG - Intergenic
944008450 2:194941173-194941195 CAACTTTGTTCTTCTTGCCCAGG - Intergenic
944188198 2:196972500-196972522 CAAATTTAAAATTATTGCCCTGG - Intronic
948023965 2:234761822-234761844 CCAATTTGAAATTCTTGAATTGG + Intergenic
1169977517 20:11346862-11346884 ACAATTTGTGATTCTTGGCATGG + Intergenic
1172710857 20:36922184-36922206 GCAATGTGTAATTCTGGACCAGG + Intronic
1173724578 20:45288512-45288534 CAAACTTGTAATGCTTGCCCTGG + Intergenic
1178045843 21:28694106-28694128 CCTGTTTGTAATTATTGGCCTGG + Intergenic
1178230630 21:30780339-30780361 CAAATTTGTAACTCTGGCCCAGG + Intergenic
1179089277 21:38249123-38249145 CGAAGCTGTAATTCTTGCCTTGG - Intronic
1182669383 22:31983218-31983240 TCAATTTGTATTTCCTGGCCGGG + Intergenic
1183238128 22:36635626-36635648 CACATTTGTAACTCTGGCCCTGG + Intronic
1184102533 22:42348336-42348358 CCACTTTGTACCTCATGCCCTGG + Intergenic
949320995 3:2810388-2810410 GCTATTTTTAATTCTTGCCTAGG + Intronic
949745642 3:7289205-7289227 CCAATTTTTAGTTCTTGTTCAGG + Intronic
950263469 3:11558759-11558781 GCTCCTTGTAATTCTTGCCCAGG + Exonic
950740221 3:15044929-15044951 TCATTTTATAATTCTTGCCTTGG + Exonic
951563991 3:23994343-23994365 GCACTTTGTATTTCTTGGCCAGG + Intergenic
952448706 3:33410068-33410090 CCAATTTGTGATACTTTGCCTGG + Intronic
952690135 3:36195931-36195953 CCACTTTGATATACTTGCCCAGG - Intergenic
956684776 3:71815805-71815827 TCTAATTGTAATTCTTGCCTGGG - Intergenic
960284537 3:115812397-115812419 CCGATTAGTAATTGTTGACCAGG + Intronic
960500747 3:118435459-118435481 CCAACTTACAATTCTTGGCCAGG - Intergenic
971533844 4:27722840-27722862 TCCATTTGTAATTCATGTCCTGG - Intergenic
973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG + Intergenic
974374242 4:61056253-61056275 CCTATTTATGATTGTTGCCCAGG + Intergenic
977229373 4:94433668-94433690 CCTACTTGTAATTCTTGGACAGG + Intergenic
977232636 4:94469767-94469789 AAAATTTTAAATTCTTGCCCTGG - Intronic
978029642 4:103924600-103924622 CAAATTTGTCATTCTTGCACAGG - Intergenic
978741258 4:112140713-112140735 CCCTTTTTTAATTCTTTCCCAGG + Intergenic
979115694 4:116819752-116819774 CAGATTTGTTTTTCTTGCCCAGG - Intergenic
983788470 4:171763619-171763641 CAACTTTGTTCTTCTTGCCCAGG - Intergenic
988669177 5:33362586-33362608 CCAATTCTTAATTATGGCCCTGG - Intergenic
990524135 5:56608112-56608134 CCTTTTTGTTCTTCTTGCCCAGG + Intergenic
996330950 5:122328265-122328287 CAAATTTGTATTTCTAGTCCTGG + Intronic
998598365 5:143558399-143558421 CAAAGTTGTATTTCTTGCTCTGG - Intergenic
999706223 5:154274677-154274699 CCAATTTGCAATTCCTGAGCTGG - Intronic
1003212142 6:4078345-4078367 TTAATTTGTGATTCTTGGCCGGG - Intronic
1004146894 6:13076329-13076351 CCAATTGATAATTATTTCCCAGG + Intronic
1006243771 6:32711031-32711053 TCAATTTGTATTTCTTATCCTGG - Intergenic
1006880801 6:37337790-37337812 CCAATCTGTTATTCATCCCCTGG + Intergenic
1006890037 6:37419142-37419164 CCAATTTGTAATACTGCCTCAGG + Intergenic
1009751646 6:67884363-67884385 TCAATTTGCAAATCTTGCGCAGG + Intergenic
1012129226 6:95470110-95470132 CGATTTTGTCATTCTTTCCCAGG + Intergenic
1012903622 6:105037804-105037826 TCAAGTTGTAACTCTTGGCCGGG - Intronic
1012921487 6:105224819-105224841 CCACTTTACAATTCATGCCCAGG - Intergenic
1018054966 6:160044211-160044233 CCATTTGGTCTTTCTTGCCCTGG + Intronic
1020041659 7:5007911-5007933 CAATTTTGTATTTCTTGACCTGG - Intronic
1020640320 7:10746601-10746623 CCACTTTGTTTTTCTTGCCCAGG - Intergenic
1021246956 7:18274994-18275016 CAAATTTGTATGTCTAGCCCAGG + Intronic
1024119313 7:46221034-46221056 CCAAGTTGTAATTCCAACCCAGG + Intergenic
1025602800 7:63015525-63015547 CCAATTTCCCATTATTGCCCAGG - Intergenic
1025746634 7:64248573-64248595 TCAAATTGTAATTCATGGCCAGG - Intronic
1026293069 7:69026160-69026182 CCAAGTTCTAGTTCTTGGCCTGG - Intergenic
1027147943 7:75711161-75711183 CTAATTTGTAAGTCTTTCACAGG - Intronic
1027458907 7:78427878-78427900 CCAATTTATAATTCTTTTTCAGG - Intronic
1030071561 7:105702449-105702471 ACAATTTATACCTCTTGCCCTGG - Intronic
1033229768 7:139587600-139587622 CCACTTTGTAATTCTTGTACTGG - Intronic
1033503715 7:141978998-141979020 CCAATTTGCCATTCTTTCCAGGG + Intronic
1033516690 7:142113709-142113731 CCAACCTGTATTTCTAGCCCAGG - Intronic
1035424832 7:158763125-158763147 TCAATCTCTAATTCTTGTCCAGG + Exonic
1036019867 8:4832450-4832472 ACAATTTGTAATTTTTTCCCTGG - Intronic
1040770510 8:50969872-50969894 AGAATCTGTAATTCTTTCCCGGG + Intergenic
1045345722 8:101291803-101291825 GCAATTTCTAATTCTTGGGCAGG + Intergenic
1046157197 8:110308227-110308249 CCAATTCTTAATTTTTGCACTGG - Intergenic
1046780985 8:118214757-118214779 TGAAATTGTAATTCTTTCCCAGG + Intronic
1048487852 8:134865337-134865359 CCATTTTGTAAATGTTGCCTGGG - Intergenic
1051784796 9:20730677-20730699 CCAAATAGGACTTCTTGCCCCGG + Intronic
1056138346 9:83650390-83650412 CAAATTTGCAAGTCTTGCCATGG - Intergenic
1060082035 9:120657820-120657842 CTAATTTGGAATTCTTTCTCTGG + Intronic
1187145440 X:16632717-16632739 CCAAAATGTAACTCTTGGCCAGG - Intronic
1187938298 X:24357135-24357157 CCTATTTCTAATTCTTCCCAAGG - Intergenic
1191085123 X:56558270-56558292 CCAGTTTGTAATTTGTGTCCTGG + Intergenic
1191987055 X:66993381-66993403 CAGCTTTGTACTTCTTGCCCAGG + Intergenic
1193419488 X:81266648-81266670 CAGATTTGTTCTTCTTGCCCAGG + Intronic
1196824205 X:119728209-119728231 TCAATTTCTTATTCTTGGCCCGG + Intergenic
1196854052 X:119966328-119966350 CCCATTTGTAATTTTTGCTTTGG - Intergenic
1197186776 X:123596248-123596270 CCAATTTGTTATACCAGCCCAGG - Intergenic
1201979539 Y:19892145-19892167 CCAATTTCTAATGCTGGGCCAGG + Intergenic