ID: 1099695013

View in Genome Browser
Species Human (GRCh38)
Location 12:86007442-86007464
Sequence TATGATACACTACCAGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099695013_1099695014 -8 Left 1099695013 12:86007442-86007464 CCATGATCTGGTAGTGTATCATA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1099695014 12:86007457-86007479 GTATCATAAGATTTACCAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 265
1099695013_1099695015 0 Left 1099695013 12:86007442-86007464 CCATGATCTGGTAGTGTATCATA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1099695015 12:86007465-86007487 AGATTTACCAAAAGGTCTAATGG 0: 1
1: 0
2: 0
3: 11
4: 138
1099695013_1099695016 1 Left 1099695013 12:86007442-86007464 CCATGATCTGGTAGTGTATCATA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1099695016 12:86007466-86007488 GATTTACCAAAAGGTCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099695013 Original CRISPR TATGATACACTACCAGATCA TGG (reversed) Intronic
913535975 1:119772757-119772779 TATGAAAAACTACCACCTCATGG - Intergenic
1065204982 10:23348566-23348588 TATGATACACTACAATTTCAAGG + Intergenic
1068022657 10:51604496-51604518 TCTGATTCACAACCACATCATGG + Intronic
1070037950 10:72745720-72745742 TATGGTATACTACCACATAATGG - Intronic
1073368140 10:102961280-102961302 AACGATACATTACCAGAGCATGG - Intronic
1076457927 10:130615717-130615739 TATGAACCTCTCCCAGATCAGGG - Intergenic
1080017400 11:27521892-27521914 TATGATAGACTATAAGATCTAGG - Intergenic
1087193462 11:95280949-95280971 TCATATACACTCCCAGATCAGGG - Intergenic
1087339244 11:96881595-96881617 TTTGGTACACTAGCAGATCTGGG + Intergenic
1095800076 12:46262823-46262845 TATAATTCAATACCAGATGATGG + Intronic
1099695013 12:86007442-86007464 TATGATACACTACCAGATCATGG - Intronic
1101268414 12:103116448-103116470 TATGACACACTGACAGACCAAGG - Intergenic
1111021028 13:82452613-82452635 TATGTTACACCACCTGAACATGG - Intergenic
1115035531 14:28852228-28852250 TAAGATAAACTACTAGAACAGGG - Intergenic
1115599288 14:34940144-34940166 TATGGAGCATTACCAGATCAGGG + Intergenic
1116217932 14:42044221-42044243 TATGATACAGGTCTAGATCAGGG + Intergenic
1124436605 15:29654782-29654804 GATTATACACTAGCAGAGCAAGG + Intergenic
1125996827 15:44169695-44169717 TATGATACAATAACAAAACAAGG + Intronic
1130890429 15:88128892-88128914 CATGCTACACTACCAGTTTAGGG + Intronic
1135120260 16:19760364-19760386 GATGATACTCTACTAGATCCTGG - Intronic
1141015201 16:80442477-80442499 TATGAGACACAACCAGCTCAGGG - Intergenic
1143043607 17:4058427-4058449 TCTGATAAACTGCAAGATCAGGG + Intronic
1149899581 17:60461862-60461884 TCTGATACACTGCTAGATTATGG - Exonic
1161121090 19:2527256-2527278 TATGAGACACTATCAGAACCGGG + Intronic
940048955 2:149440549-149440571 GATGATTCACCAGCAGATCAGGG + Intronic
942480502 2:176382656-176382678 TATAATTCATTTCCAGATCATGG - Intergenic
947532488 2:230921311-230921333 TAAGGTAGACTAGCAGATCAGGG + Intronic
948253039 2:236545669-236545691 TATGAAACACTACGATTTCATGG + Intergenic
1177302246 21:19262982-19263004 TGTAATACACTCCCAGAACATGG - Intergenic
1182891414 22:33822026-33822048 TATTATAGATTACAAGATCAGGG - Intronic
950195045 3:11003300-11003322 TATAATAAACCACCTGATCAGGG - Intronic
957838033 3:85624869-85624891 TTTGATACATCAGCAGATCATGG + Intronic
958429660 3:94023099-94023121 TATGGTACACTCCCAAATCAAGG - Intronic
962450989 3:135516835-135516857 TAGGATACACTCTCAGAGCAAGG + Intergenic
965156507 3:165065492-165065514 TATGATATTCTACCAGATACAGG + Intronic
966357941 3:179101973-179101995 AATGACACTCAACCAGATCAGGG - Intergenic
984654806 4:182306142-182306164 TATGGTTCACTATCATATCACGG - Intronic
991123056 5:63038540-63038562 TTTCAAACACTACCAGATTAAGG - Intergenic
994679730 5:102870940-102870962 TTTGATAAACTGCCAGTTCATGG + Intronic
995871790 5:116750911-116750933 TTTGATACTCTAACAGATCTGGG - Intergenic
1006957510 6:37887059-37887081 GATAATACATTACCAGATTAAGG - Intronic
1012953466 6:105543236-105543258 TATGACATGCTACCATATCAAGG - Intergenic
1015133836 6:129845326-129845348 TCTGATTCAATACCAGACCAGGG + Intronic
1016694826 6:146980866-146980888 TATGATGCCCTACCAGCTAAGGG + Intergenic
1021662883 7:22938432-22938454 TCTGACACACAACCAAATCAAGG + Intergenic
1034913097 7:155013877-155013899 TATGATACAGAACTAGATCTTGG - Intergenic
1045836939 8:106533674-106533696 TATGATATGCTACCTGAACAGGG + Intronic
1046261347 8:111772165-111772187 TAAGACAAAGTACCAGATCATGG + Intergenic
1047656088 8:126978958-126978980 TATGACAGACTTCCAGCTCATGG - Intergenic
1053448305 9:38170543-38170565 TATGACATACTACAGGATCAAGG - Intergenic
1053581730 9:39411926-39411948 TAAGATACACTAACAGGCCATGG + Intergenic
1053846153 9:42239260-42239282 TAAGATACACTAACAGGCCATGG + Intergenic
1054103310 9:60970658-60970680 TAAGATACACTAACAGGCCATGG + Intergenic
1054583046 9:66936179-66936201 TAAGATACACTAACAGGCCATGG - Intergenic
1057715937 9:97496248-97496270 TGAGATACACTACTACATCAGGG - Intergenic
1059072521 9:111153558-111153580 TTTTAAACACTCCCAGATCATGG - Intergenic
1061139348 9:128754931-128754953 GATGATTCACTCCCTGATCATGG + Intronic
1186760352 X:12716470-12716492 TATGAAACGCTACTAGATGAGGG + Exonic
1189332460 X:40152302-40152324 TTTGATATACTACCGGATCTAGG + Intronic
1193431925 X:81418381-81418403 TATGATACAGTAGAAGAGCATGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198768591 X:140104414-140104436 TATGATTCACTTCCACTTCAAGG + Intergenic
1199509702 X:148608153-148608175 TATAATCCAATACCAGACCATGG - Intronic