ID: 1099711741

View in Genome Browser
Species Human (GRCh38)
Location 12:86235152-86235174
Sequence TCTATAGACCCGGAGTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099711741 Original CRISPR TCTATAGACCCGGAGTTCAT GGG (reversed) Intronic
906333362 1:44906858-44906880 TATATAGACTCGGTGTTCAGAGG - Intronic
911605114 1:99896210-99896232 TCTATAGTAATGGAGTTCATAGG + Intronic
923407456 1:233677009-233677031 TCTAAAGACCCAGAGTCAATAGG + Intergenic
1069522294 10:69132802-69132824 TCTATTTAACCGTAGTTCATAGG + Intronic
1078077020 11:8171476-8171498 TCTATAGTCCAGGAGTCCAGAGG - Intergenic
1080873347 11:36256280-36256302 TCTATGGACCAGGAATTCAGGGG + Intergenic
1091136708 11:133197663-133197685 GCTATTGACTCGGAATTCATTGG - Intronic
1099711741 12:86235152-86235174 TCTATAGACCCGGAGTTCATGGG - Intronic
1114387501 14:22270142-22270164 TCTAAAGACCTGGAATTAATAGG + Intergenic
1119152272 14:72372636-72372658 TCTATAGAGTCACAGTTCATAGG + Intronic
1121548115 14:94777631-94777653 TCTGCAGACCAGGAGTTCTTGGG + Intergenic
1124871278 15:33545455-33545477 TCTTTAGCCCAGGATTTCATAGG + Intronic
1128732163 15:70028695-70028717 TCTATAGAGCCAGACTTCCTGGG - Intergenic
1138137146 16:54532921-54532943 TCTATAGAGCATGGGTTCATAGG + Intergenic
1141370560 16:83482520-83482542 TCTATGGAGCCAGAGTTCCTCGG + Intronic
1156693258 18:39734479-39734501 GCTACAGACCAGGAGTTCAGAGG + Intergenic
1167856162 19:52242099-52242121 TCTATACATCTGGAGTTCCTGGG + Intergenic
929988202 2:46758917-46758939 TACAAAGACCCAGAGTTCATTGG + Exonic
933587220 2:84192431-84192453 TCTATAGACAGGGAGTGCAAGGG + Intergenic
937172808 2:119893476-119893498 TTTATAGACCTGGAGTTGAGAGG + Intronic
943656462 2:190513775-190513797 TCTATATACCCTTAGTTCCTGGG + Intronic
1177923773 21:27188003-27188025 TCTCTAGACCTGGAGTTTATGGG - Intergenic
959895165 3:111597037-111597059 TCTATAGGCCCAGACTTCTTGGG + Intronic
979823870 4:125208471-125208493 TCTATAAACGTGGATTTCATTGG + Intergenic
997612720 5:135226457-135226479 TCTAGAGAACCGGAGTTCTTGGG + Intronic
1009285963 6:61817827-61817849 TCAATAGAGCCAGAGTTAATTGG - Intronic
1013735540 6:113222552-113222574 TACAAAGACCCAGAGTTCATTGG + Intergenic
1018831156 6:167444567-167444589 TCTATAGACCAGAGGTCCATGGG - Intergenic
1022403870 7:30068045-30068067 TCTACAGACTGGTAGTTCATGGG + Intronic
1026465721 7:70652437-70652459 TCTAGACACAAGGAGTTCATGGG + Intronic
1027867132 7:83662490-83662512 TCTAGAAAACCGTAGTTCATAGG - Intergenic
1036494950 8:9261892-9261914 TCTACAGACCCGGTGCTCAGGGG - Intergenic
1048757998 8:137759895-137759917 TATATAGAGTAGGAGTTCATGGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1188190063 X:27161849-27161871 TCAATAGAGCTGGACTTCATAGG + Intergenic
1189138680 X:38577908-38577930 TCTAGTGACCAGGAGTTCACTGG - Intronic
1192626547 X:72734409-72734431 TATATAAACCTGGAGTTCAAGGG - Intergenic