ID: 1099713406

View in Genome Browser
Species Human (GRCh38)
Location 12:86259297-86259319
Sequence ATCAGTCTGCACATGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099713403_1099713406 8 Left 1099713403 12:86259266-86259288 CCTTTGGAAAAAAGTCTGATGAT 0: 1
1: 0
2: 7
3: 34
4: 372
Right 1099713406 12:86259297-86259319 ATCAGTCTGCACATGTATCTGGG 0: 1
1: 0
2: 1
3: 46
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099713406 Original CRISPR ATCAGTCTGCACATGTATCT GGG Intronic
900887522 1:5425728-5425750 ATCAGACTGGACATTTATTTAGG + Intergenic
902149607 1:14432582-14432604 CACATTCTGCACATGTATCCCGG - Intergenic
906524047 1:46484215-46484237 ATCTCTCGGCACATGTATGTAGG + Intergenic
907350399 1:53825056-53825078 CTCAGTCTGCCCGAGTATCTGGG - Intronic
907544105 1:55244354-55244376 CTCAGTCTGCTCATTTACCTAGG + Intergenic
907824812 1:58005316-58005338 ATGAGTCTGCCCAAATATCTAGG + Intronic
908478981 1:64518314-64518336 TACATTCTGCACATGTATCCCGG - Intronic
909779014 1:79519435-79519457 AGCAGTTTGCACAAGTATCTTGG + Intergenic
910991289 1:93059262-93059284 AACATTCTGCACATGTATCCCGG - Intergenic
911999448 1:104812424-104812446 CTCAGTCTGCCCAGGGATCTAGG + Intergenic
912186498 1:107282869-107282891 ATCTGTCAGCACCTTTATCTTGG - Intronic
912608141 1:111014047-111014069 CACATTCTGCACATGTATCCCGG + Intergenic
912774649 1:112497933-112497955 CACATTCTGCACATGTATCCCGG - Intronic
913056933 1:115170802-115170824 AGAAGTCTGCACATGATTCTAGG - Intergenic
913409716 1:118537671-118537693 ATCAGCCTGCACATGATCCTAGG + Intergenic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
915701833 1:157803840-157803862 CTCACTGTGCACATTTATCTGGG + Exonic
917772522 1:178295267-178295289 AACATTCTGCACATGTACCCTGG - Intronic
917817819 1:178727751-178727773 TTCATTCTGCACATGTGTATTGG + Intronic
918678632 1:187322839-187322861 CACATTCTGCACATGTATCCTGG + Intergenic
918729123 1:187968209-187968231 CACATTCTGCACATGTATCCTGG - Intergenic
918846526 1:189622066-189622088 CACATTCTGCACATGTATCCCGG + Intergenic
918980017 1:191545212-191545234 CACATTCTGCACATGTATCCTGG - Intergenic
919158265 1:193795760-193795782 CACATTCTGCACATGTATCCTGG - Intergenic
919294953 1:195686007-195686029 TTGAGTGTGCACATGGATCTGGG - Intergenic
919468758 1:197953002-197953024 ATCAGTCTCCCCACGTATTTGGG - Intergenic
920405954 1:205710969-205710991 TTCAGTCTGCACTTCTATTTCGG + Intergenic
920443561 1:205998439-205998461 ATCTGTGTGCACAGGAATCTAGG + Intronic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
920994044 1:210970126-210970148 CACATTCTGCACATGTATCCTGG - Intronic
921750297 1:218784230-218784252 ATCAGACTGCACAAGGCTCTAGG - Intergenic
922147638 1:222963855-222963877 CACATTCTGCACATGTATCCCGG + Intronic
923464493 1:234236090-234236112 ATGTATCTGGACATGTATCTGGG - Intronic
923472227 1:234302130-234302152 CACATTCTGCACATGTATCCTGG + Intronic
923654537 1:235904317-235904339 CACATTCTGCACATGTATCCTGG + Intergenic
923795582 1:237151869-237151891 CACATTCTGCACATGTATCCTGG - Intronic
923820064 1:237428729-237428751 CACATTCTGCACATGTATCCTGG + Intronic
924368580 1:243322530-243322552 ATCAGTCTGCACTAGTCCCTTGG + Intronic
1064045307 10:12008704-12008726 CACATTCTGCACATGTATCTTGG - Intronic
1064729898 10:18319577-18319599 TACATTCTGCACATGTATCCTGG + Intronic
1065251031 10:23814253-23814275 ATCATTCTGCTCCTATATCTGGG + Intronic
1065378552 10:25066294-25066316 AACATCCTGCACATGTACCTGGG + Intergenic
1065447384 10:25817232-25817254 TTCATTCTGCAAATGTATATAGG - Intergenic
1065461751 10:25974259-25974281 CACATTCTGCACATGTATCCCGG + Intronic
1065649135 10:27868804-27868826 CACATTCTGCACATGTATCTTGG + Intronic
1066161912 10:32742696-32742718 ACCAGTCAGCACATTGATCTTGG - Intronic
1067256299 10:44645756-44645778 CACATTCTGCACATGTATCCTGG + Intergenic
1067259473 10:44675651-44675673 ATCTGTCTGCACCTTGATCTTGG + Intergenic
1067299677 10:44997068-44997090 ATCTTTCTGCACATATTTCTGGG - Intergenic
1067946571 10:50693083-50693105 TACATTCTGCACATGTATCCTGG - Intergenic
1068404140 10:56568568-56568590 CACATTCTGCACATGTATCCTGG - Intergenic
1069114765 10:64491097-64491119 ATCAGTATGCAGTCGTATCTGGG + Intergenic
1069387031 10:67893157-67893179 CGCATTCTGCACATGTATCCCGG - Intronic
1069926496 10:71854309-71854331 CTCACTCTGCCCATGTTTCTTGG - Intergenic
1070397666 10:76025564-76025586 TTCAGTGAGCACATGCATCTGGG - Intronic
1070524918 10:77287712-77287734 TTCAGCTTGCACATGTGTCTTGG - Intronic
1070685882 10:78480739-78480761 ATCAGTGTGCACATGCACATGGG - Intergenic
1070881884 10:79858084-79858106 TACATTCTGCACATGTATCCTGG - Intergenic
1071471998 10:85990029-85990051 ATCTGTCTGCACTTGGATCTAGG + Intronic
1071648462 10:87374398-87374420 TACATTCTGCACATGTATCCTGG - Intergenic
1073954185 10:108848945-108848967 ATCTTTCTCCACATGTATTTTGG - Intergenic
1074007263 10:109439914-109439936 CACATTCTGCACATGTATCCTGG - Intergenic
1074172184 10:110952575-110952597 CACATTCTGCACATGTATCCTGG - Intronic
1075251065 10:120874421-120874443 CGCATTCTGCACATGTATCCAGG - Intronic
1075485307 10:122817552-122817574 ATCATTCTACACATGTCTGTGGG + Intergenic
1077260352 11:1615421-1615443 TTCCGTGTGCACATGTCTCTGGG - Intergenic
1077391808 11:2303776-2303798 ATCAGTCTGGACCTGGACCTGGG - Intronic
1077732051 11:4741738-4741760 CACATTCTGCACATGTATCCTGG + Intronic
1078524446 11:12089941-12089963 CACATTCTGCACATGTATCCTGG + Intergenic
1078972944 11:16436169-16436191 ATGTTTCTGCACATGTATCCCGG + Intronic
1079483433 11:20908644-20908666 CACATTCTGCACATGTATCCTGG + Intronic
1079686724 11:23368044-23368066 CACATTCTGCACATGTATCTTGG + Intergenic
1080033797 11:27689729-27689751 CACATTCTGCACATGTATCCCGG - Intronic
1080738424 11:35040404-35040426 CAAAGTCTGTACATGTATCTGGG + Intergenic
1080844264 11:36013318-36013340 CACATTCTGCACATGTATCTCGG - Intronic
1082108729 11:48248657-48248679 CACATTCTGCACATGTATCCCGG - Intergenic
1082109008 11:48252531-48252553 ATCATTCTGCACATCAACCTTGG - Intergenic
1084222053 11:67688201-67688223 ATCAGTCAGCACCTTGATCTTGG + Intergenic
1086780167 11:90894107-90894129 CACATTCTGCACATGTATCCCGG - Intergenic
1086972836 11:93102171-93102193 CACACTCTGCACATGTATCCCGG - Intergenic
1087404351 11:97711650-97711672 CACATTCTGCACATGTATCCTGG + Intergenic
1087437231 11:98136613-98136635 GTCTTTCTGCACATGTGTCTTGG + Intergenic
1087739834 11:101874485-101874507 CACATCCTGCACATGTATCTTGG - Intergenic
1087764078 11:102130798-102130820 ATCAGTCTGAACATGTGTAGAGG - Intronic
1088360016 11:108979846-108979868 CACATTCTGCACATGTATCCTGG - Intergenic
1089739239 11:120571033-120571055 ATCAGTCAGCCCCTGTGTCTTGG + Intronic
1090734883 11:129603262-129603284 CACATTCTGCACATGTATCCTGG + Intergenic
1091081782 11:132677103-132677125 TTCAGTCTCCACATATTTCTTGG - Intronic
1092329040 12:7565857-7565879 CACATTCTGCACATGTATCTGGG + Intergenic
1092504138 12:9078091-9078113 CACGTTCTGCACATGTATCTCGG - Intronic
1092932443 12:13329100-13329122 CTCAGTCTGCACTTGAATTTAGG - Intergenic
1092985631 12:13843070-13843092 CACATTCTGCACATGTATCCTGG - Intronic
1093276975 12:17140803-17140825 CACATTCTGCACATGTATCCTGG - Intergenic
1093403945 12:18781570-18781592 CACATTCTGCACATGTATCCTGG + Intergenic
1093588754 12:20873627-20873649 TACATTCTGCACATGTATCCTGG - Intronic
1094256336 12:28432105-28432127 CACATCCTGCACATGTATCTTGG - Intronic
1095130641 12:38538226-38538248 CTCATTCTGCAAATGTATCCCGG + Intergenic
1095260436 12:40093116-40093138 ATGAGTCTCTCCATGTATCTAGG - Intronic
1097355391 12:58595038-58595060 CACATTCTGCACATGTATCCCGG + Intronic
1098176393 12:67796108-67796130 CACATTCTGCACATGTATCATGG + Intergenic
1098434542 12:70454479-70454501 CACATTCTGCACATGTATCCCGG - Intergenic
1098511026 12:71314342-71314364 CTCCCTCTGCACATGTATCCTGG - Intronic
1098761204 12:74427547-74427569 CACATTCTGCACATGTATCCCGG - Intergenic
1099277968 12:80602482-80602504 ATCTGTCTGCACCTTCATCTTGG - Intronic
1099713406 12:86259297-86259319 ATCAGTCTGCACATGTATCTGGG + Intronic
1100101626 12:91113894-91113916 AACATTCTGCACATGTATCCCGG + Intergenic
1100805194 12:98276035-98276057 AGCACTCTGCACTTGTTTCTTGG - Intergenic
1101059975 12:100960565-100960587 CACATTCTGCACATGTATCCTGG + Intronic
1101691003 12:107081411-107081433 AACAGGCTATACATGTATCTGGG - Intronic
1103047304 12:117747563-117747585 CACATTCTGCACATGTATCCCGG + Intronic
1104089278 12:125501393-125501415 CACATTCTGCACATGTACCTTGG - Intronic
1104304622 12:127598399-127598421 CACACTCTGCACATGTATCCCGG + Intergenic
1105610371 13:21963764-21963786 CACATCCTGCACATGTATCTTGG + Intergenic
1105968762 13:25408042-25408064 CACATTCTGCACATGTATCCTGG + Intronic
1106026099 13:25956912-25956934 ATCAGTCTACACATCTGTTTTGG - Intronic
1107055882 13:36102991-36103013 ATGAGTCTGCACATTTATGTGGG - Intronic
1107413578 13:40179750-40179772 ATCAGTCTGCTCAGATATCAAGG - Intergenic
1108141918 13:47432436-47432458 CACATTCTGCACATGTATCCCGG + Intergenic
1109016002 13:57015251-57015273 TACTTTCTGCACATGTATCTTGG - Intergenic
1109417701 13:62064548-62064570 CACATTCTGCACATGTATCTTGG + Intergenic
1110030202 13:70602019-70602041 ATCATTATGCACATGGATTTAGG - Intergenic
1110346689 13:74456302-74456324 CACATTCTGCACATGTATCCTGG + Intergenic
1110454861 13:75679927-75679949 CACATTCTGCACATGTATCCTGG - Intronic
1110568532 13:76980017-76980039 CACGTTCTGCACATGTATCTTGG + Intergenic
1110960779 13:81622561-81622583 CACATCCTGCACATGTATCTCGG - Intergenic
1111232471 13:85362679-85362701 CACATTCTGCACATGTATCCTGG - Intergenic
1111721637 13:91953686-91953708 ATCTGTCAGCACATTGATCTTGG - Intronic
1111908266 13:94281209-94281231 CACATTCTGCACATGTGTCTTGG - Intronic
1112680435 13:101758778-101758800 TTCAGTGTGCATTTGTATCTGGG + Intronic
1112762422 13:102706327-102706349 CACATTCTGCACATGTATCCTGG - Intergenic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1113572237 13:111366281-111366303 ATCAGACTCCTGATGTATCTGGG + Intergenic
1113648030 13:112012621-112012643 TTCAGTCTTCACCTGTGTCTTGG - Intergenic
1113979919 13:114266211-114266233 ATCTGTCTGCTTATGTGTCTTGG + Intronic
1114804177 14:25815012-25815034 CACATTCTGCACATGTATCCTGG + Intergenic
1115167590 14:30466403-30466425 ACAAACCTGCACATGTATCTTGG - Intergenic
1115600346 14:34949990-34950012 ATCAGTATGCTAATGCATCTTGG + Intergenic
1115673629 14:35644877-35644899 CACATTCTGCACATGTATCCTGG + Intronic
1116255231 14:42546377-42546399 ATTATTCTGAACATTTATCTTGG - Intergenic
1116280059 14:42895195-42895217 CACATTCTGCACATGTATCCCGG - Intergenic
1116650052 14:47578379-47578401 CACATTCTGCACTTGTATCTTGG + Intronic
1116717247 14:48443071-48443093 CACATTCTGCACATGTATCCCGG + Intergenic
1116902496 14:50375067-50375089 CACATTCTGCACATGTATCCCGG + Intronic
1116975565 14:51111826-51111848 CACATTCTGCACATGTATCCCGG + Intergenic
1118216425 14:63812861-63812883 CACATTCTGCACATGTATCCTGG + Intergenic
1121156580 14:91690792-91690814 ATCTGCCTGCACCTTTATCTTGG - Intronic
1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG + Intronic
1125118588 15:36125213-36125235 CACATTCTGCACATGTATCCTGG - Intergenic
1126276082 15:46882962-46882984 CACATTCTGCACAGGTATCTCGG + Intergenic
1127154923 15:56113627-56113649 CACATTCTGCACATGTATCCCGG + Intronic
1127910803 15:63414643-63414665 ATCAGACATCACATGTGTCTTGG - Intergenic
1129545710 15:76392858-76392880 ATCTGGCTGCAAATGTATCCTGG + Intronic
1130191295 15:81738520-81738542 CACATTCTGCACATGTATCCTGG + Intergenic
1131477228 15:92750461-92750483 CACATCCTGCACATGTATCTCGG - Intronic
1131561536 15:93447675-93447697 TACATCCTGCACATGTATCTGGG - Intergenic
1131942034 15:97577532-97577554 CACATTCTGCACATGTATCCTGG - Intergenic
1132168851 15:99626710-99626732 TTCAGTCTGTACATGAATTTGGG + Intronic
1132516016 16:366407-366429 GTCATTCTGCACATGCAGCTGGG + Intergenic
1133707923 16:8372942-8372964 AACATTCTGCCCATGTATCCCGG + Intergenic
1134504639 16:14794983-14795005 ATCAGTCTCCACAAGCATTTGGG + Intronic
1134575934 16:15333926-15333948 ATCAGTCTCCACAAGCATTTGGG - Intergenic
1134726509 16:16422575-16422597 ATCAGTCTCCACAAGCATTTGGG + Intergenic
1134940922 16:18289284-18289306 ATCAGTCTCCACAAGCATTTGGG - Intergenic
1135297414 16:21294363-21294385 CACATTCTGCACATGTATCCCGG - Intronic
1135673352 16:24393383-24393405 ATGAACCTGCACATGTATCCTGG - Intergenic
1135759924 16:25129262-25129284 CACATTCTGCACATGTATCCTGG + Intronic
1135903725 16:26490979-26491001 ATTAGTCTGCAGCTGTATTTTGG + Intergenic
1136527951 16:30845000-30845022 TTCACTCTGGACATGCATCTAGG - Intronic
1138402261 16:56756155-56756177 GACATTCTGCACATGTATCCCGG - Intronic
1140676265 16:77333434-77333456 CACATTCTGCACATGTATCTTGG + Intronic
1141126596 16:81404908-81404930 AACATTCTGCGCATGTATCCCGG - Intergenic
1141624165 16:85252765-85252787 CTCAGACTGCACCTGTAACTCGG - Intergenic
1142844294 17:2660261-2660283 CACATTCTGCACATGTATCCCGG - Intronic
1143910620 17:10245832-10245854 ATCTGTCTGCACCTTGATCTTGG - Intergenic
1145293659 17:21571362-21571384 CACATTCTGCACATGTATCCTGG + Intronic
1148172647 17:45536039-45536061 ATCAGTCTGGACCTGTGTATAGG + Intergenic
1148276623 17:46309410-46309432 ATCAGTCTGGACCTGTGTATAGG - Intronic
1148298740 17:46526998-46527020 ATCAGTCTGGACCTGTGTATAGG - Intronic
1148363274 17:47031495-47031517 ATCAGTCTGGACCTGTGTATAGG - Intronic
1149192166 17:54076132-54076154 ATGATTCTGCAGATGAATCTGGG + Intergenic
1150403851 17:64882959-64882981 ATCAGTCTGGACCTGTGTATAGG + Intronic
1151092012 17:71451185-71451207 CACATTCTGCACATGTATCCTGG + Intergenic
1152416826 17:80168083-80168105 CACATTCTGCACATGTATCCCGG - Intergenic
1152982367 18:290470-290492 CACATTCTGCACATGTATCCCGG + Intergenic
1153360356 18:4188331-4188353 CACATTCTGCACATGTATCCCGG - Intronic
1153463381 18:5362194-5362216 CACACTCTGCACATGTATCCTGG + Intergenic
1153764596 18:8363394-8363416 GTCAGTCTTCACATGTGTCAGGG - Intronic
1154023805 18:10688017-10688039 CACATTCTGCACATGTATCCTGG - Intronic
1154239861 18:12642895-12642917 CACATTCTGCACATGTATCCTGG + Intronic
1155661471 18:28253765-28253787 AAAATTCTGCACATGTATCCGGG - Intergenic
1155976972 18:32141511-32141533 ATTAGTCTGCACATGAATCTGGG - Intronic
1156022361 18:32614757-32614779 CACATTCTGCACATGTGTCTTGG - Intergenic
1156583146 18:38402597-38402619 ATCCGTTTGCAAATGTCTCTTGG - Intergenic
1157064544 18:44332397-44332419 ATCATTCTGAACATAGATCTTGG - Intergenic
1158351495 18:56568760-56568782 CACATTCTGCACATGTATCTCGG + Intergenic
1158627275 18:59082170-59082192 CTCAGTTTGCACACGTATCCTGG - Intergenic
1159733276 18:72059733-72059755 GTCAGTCTGGAAATGTGTCTGGG - Intergenic
1159762325 18:72443647-72443669 TACATTCTGCACATGTATCCTGG + Intergenic
1159961314 18:74557626-74557648 ATCAGTGTGCACATGTGTGGGGG - Intronic
1160133340 18:76249394-76249416 CACATTCTGCACATGTATCTGGG + Intergenic
1160369488 18:78360091-78360113 AACATCCTGCACATGTATCCTGG + Intergenic
1162864024 19:13530232-13530254 CACATTCTGCACATGTATCCTGG + Intronic
1164163180 19:22644278-22644300 CACATTCTGCACATGTATCCTGG - Intronic
1164763914 19:30748566-30748588 ATTAGTCAGCACCTGGATCTTGG - Intergenic
1164854261 19:31508897-31508919 CACATTCTGCACATGTATCCTGG - Intergenic
1165903524 19:39179632-39179654 ATCAGTCTGCACATGGACTGTGG - Intronic
1168435246 19:56311688-56311710 CACAGCCTGCACATGTATCGTGG - Intronic
925053899 2:840644-840666 CACATTCTGCACATGTATCCTGG + Intergenic
925268576 2:2585088-2585110 CACATTCTGCACATGTATCCTGG + Intergenic
925664278 2:6236859-6236881 TTCAATCTGCACATTTATTTTGG + Intergenic
926318579 2:11731089-11731111 CACATTCTGCACATGTATCCCGG - Intronic
926927249 2:17999723-17999745 AACATTCTACACATATATCTTGG + Intronic
927695676 2:25238185-25238207 CCCAATATGCACATGTATCTTGG + Intronic
930478606 2:51917364-51917386 CACATTCTGCACATGTATCCTGG + Intergenic
930671478 2:54156282-54156304 CACATTCTGCACATGTATCCTGG - Intronic
930911952 2:56639969-56639991 AACTTTCTGCACATGAATCTAGG - Intergenic
931211064 2:60195687-60195709 CACATTCTGCACATGTATCCTGG - Intergenic
931429997 2:62201618-62201640 CTCATTCTGCAAATGTAACTTGG + Intronic
931547239 2:63402445-63402467 CACATTCTGCACATGTATCCTGG + Intronic
932045951 2:68350049-68350071 CACATTCTGCACATGTATCCTGG + Intergenic
932269708 2:70398786-70398808 CTCAGTCTGCAGATGTCCCTTGG + Intergenic
933020303 2:77182514-77182536 CACATTCTGCACATGTATCCTGG + Intronic
933356998 2:81223350-81223372 CACATTCTGCACATGTATCCTGG + Intergenic
933392817 2:81693669-81693691 AGCAGTCTTCACAAGTCTCTTGG + Intergenic
933557839 2:83852236-83852258 CACATTCTGCACATGTATCCCGG + Intergenic
934016895 2:87897490-87897512 CACATTCTGCACATGTACCTCGG - Intergenic
935022709 2:99247072-99247094 AAAAGACTGCACATGTATTTAGG - Intronic
935852658 2:107239531-107239553 CACATTCTGCACATGTATCCTGG + Intergenic
937837342 2:126485218-126485240 CACACTCTGCACATGTATCCCGG - Intergenic
937893388 2:126957666-126957688 AACATTCTGCACATGTATCCCGG - Intergenic
938054173 2:128201283-128201305 ATAAGTCTGCATATATATTTTGG - Intergenic
938857258 2:135326494-135326516 CACATTCTGCACATGTATCCCGG - Intronic
939540245 2:143485103-143485125 TACACTCTGCACATGTATCCCGG - Intronic
940218620 2:151327529-151327551 CACATTCTGCACATGTATCCCGG + Intergenic
940249175 2:151655318-151655340 ATCAGGCATCACATGAATCTTGG + Exonic
940613831 2:156025664-156025686 CACATTCTGCACATGTATCCCGG + Intergenic
941002781 2:160219146-160219168 CACATTCTGCACATGTATCCTGG + Intronic
941020262 2:160400274-160400296 AAAAGCTTGCACATGTATCTCGG + Intronic
941608526 2:167631827-167631849 CACATTCTGCACATGTATCCCGG - Intergenic
941973913 2:171382684-171382706 CACATTCTGCACATGTATCCCGG + Intronic
942147207 2:173038714-173038736 CACATTCTGCACATGTATCCTGG + Intronic
942547580 2:177080701-177080723 CACATTCTGCACATGTATCCTGG + Intergenic
942872000 2:180746264-180746286 CACATTCTGCACGTGTATCTTGG - Intergenic
943482666 2:188440903-188440925 GTCAGTCTTCAGATGTATGTTGG + Intronic
943638790 2:190336350-190336372 CGCATTCTGCACATGTATCCCGG - Intronic
946868805 2:224067356-224067378 CACGTTCTGCACATGTATCTTGG + Intergenic
946975397 2:225142710-225142732 CACATTCTGCACATGTATCCTGG + Intergenic
947034042 2:225830695-225830717 TGCATTCTGCACATGTATCCTGG + Intergenic
1170734461 20:19002231-19002253 CTCAGTCTGGAAATGTCTCTAGG - Intergenic
1170803404 20:19609429-19609451 CACAGTCTGCACATGTATCCTGG - Intronic
1172207238 20:33172368-33172390 CACATTCTGCACATGTATCCCGG + Intronic
1172516040 20:35534248-35534270 ACAAACCTGCACATGTATCTCGG - Intergenic
1172736484 20:37129761-37129783 CACATTCTGCACATGTATCCTGG - Intronic
1173746923 20:45444698-45444720 ATCAGTCTCCCCAAGTATCCCGG + Intergenic
1174687218 20:52467578-52467600 CACATTCTGCACATGTATCCTGG - Intergenic
1174735988 20:52966406-52966428 CACATTCTGCACATGTATCCCGG - Intergenic
1175671775 20:60909486-60909508 CACATTCTGCACATGTATCCTGG - Intergenic
1176961945 21:15168896-15168918 ATGAACCTGCACATGTATCCTGG + Intergenic
1177099703 21:16884901-16884923 CACATTCTGCACATGTATCCTGG + Intergenic
1177140985 21:17357829-17357851 TTCAGTCTGTAGATGTCTCTGGG + Intergenic
1177449778 21:21251183-21251205 CACATTCTGCACATGTATCCTGG - Intronic
1177455022 21:21326944-21326966 AACAGTCTGGACATTTCTCTCGG - Intronic
1177458483 21:21376786-21376808 TTAAGTCTGCACATTTACCTTGG - Intronic
1177866743 21:26521165-26521187 CACATCCTGCACATGTATCTTGG + Intronic
1177914475 21:27071684-27071706 CACATTCTGCACATGTATCCTGG + Intergenic
1177956021 21:27600437-27600459 CACTGTCTGCACATGTATCTTGG - Intergenic
1177995925 21:28097457-28097479 CACATTCTGCACATGTATCCTGG + Intergenic
1178880246 21:36444181-36444203 CACGCTCTGCACATGTATCTCGG - Intergenic
1179492925 21:41752961-41752983 CACATTCTGCACATGTATCCCGG + Intronic
1184930038 22:47674182-47674204 AACCTTCTGCACATGTATCCCGG + Intergenic
950390867 3:12695546-12695568 CACATTCTGCACATGCATCTTGG + Intergenic
951608655 3:24466112-24466134 AGAAGGCTGCACATGTATGTTGG - Intronic
952659503 3:35828073-35828095 CACATTCTGCACATGTATCCCGG + Intergenic
952679931 3:36079886-36079908 TACATTCTGCACATGTATCCTGG - Intergenic
953379933 3:42462187-42462209 ATGGGCCTGTACATGTATCTGGG - Intergenic
954663536 3:52238509-52238531 GGCAGTGTGCACATGTATGTGGG - Intronic
954829169 3:53404053-53404075 CACATTCTGCACATGTATCCTGG - Intergenic
956872618 3:73432831-73432853 ATCATTCTTCAAATGTGTCTTGG - Intronic
957219738 3:77366485-77366507 ATCTGCCTGCACATTGATCTTGG + Intronic
958615044 3:96482602-96482624 CACATTCTGCACATGTATCCCGG - Intergenic
958951062 3:100416744-100416766 CACATTCTGCACATGTATCCTGG - Intronic
959003269 3:100989592-100989614 ATCAGATTACACTTGTATCTTGG + Intronic
959238718 3:103759691-103759713 CACATTCTGCACATGTATCCTGG + Intergenic
959542586 3:107557323-107557345 ATCATTTTGCACAGCTATCTTGG - Intronic
959882993 3:111467936-111467958 CACATCCTGCACATGTATCTTGG - Intronic
962874410 3:139524830-139524852 ATCTGTTGGCACATGTCTCTGGG - Intronic
964709207 3:159653717-159653739 CACATTCTGCACATGTATCCCGG + Intronic
964761505 3:160138590-160138612 CACATTCTGCACATGTATCCCGG + Intergenic
964924150 3:161935748-161935770 ATCAATCTCCCCATGCATCTAGG - Intergenic
965328560 3:167339680-167339702 TACATTCTGCACATGTATCCTGG - Intronic
965705315 3:171500622-171500644 CTCAGGCTGCCCATGTAGCTGGG + Intergenic
966249899 3:177853125-177853147 CACGGTCTGCACATGTATCCCGG + Intergenic
966539081 3:181069387-181069409 CACATTCTGCACATGTATCCCGG - Intergenic
967365222 3:188678867-188678889 ATAAGTCTGCAGATGTAGGTAGG + Intronic
967373407 3:188773976-188773998 ATCAGTCTCCACTTGTCTGTTGG - Intronic
968394925 4:226694-226716 ACAAACCTGCACATGTATCTAGG + Intergenic
969138106 4:5047429-5047451 CACATTCTGCACATGTATCCCGG + Intergenic
969847986 4:9934672-9934694 TACATTCTGCACATGTATCCTGG - Intronic
969900047 4:10340682-10340704 GACATTCTGCACATGTATCCCGG + Intergenic
970160621 4:13185348-13185370 CTCATTCTGCACATGTATCCTGG - Intergenic
970411897 4:15817015-15817037 AGCAGTCTGCAAGTGTAACTTGG - Intronic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
971124089 4:23733400-23733422 CACATTCTGCACATGTATCCTGG + Intergenic
971428995 4:26543835-26543857 CACATTCTGCACATGTATCCTGG - Intergenic
971432124 4:26579521-26579543 AACATTCTGCACAGGTATCCCGG - Intronic
971478483 4:27093660-27093682 CACATTCTGCACATGTATCCTGG + Intergenic
972907896 4:43773711-43773733 ATGAGTGTGCAAATGTCTCTTGG - Intergenic
973018147 4:45167168-45167190 CACATTCTGCACATGTATCCTGG - Intergenic
973589338 4:52424928-52424950 CACATTCTGCACATGTATCCTGG - Intergenic
973864774 4:55101516-55101538 AGCATTCTGCACATGTATCCCGG - Intronic
974302993 4:60093768-60093790 CACATTCTGCACATGTATCCTGG + Intergenic
974443997 4:61955594-61955616 ACAAATCTGCACATGTATCCTGG - Intronic
975212390 4:71716474-71716496 CACATTCTGCACATGTATCCTGG - Intergenic
975429752 4:74274971-74274993 CACATTCTGCACATGTATCCTGG - Intronic
975619786 4:76284873-76284895 AACATTCTGCACATGTATCCCGG - Intronic
976762976 4:88569845-88569867 ATAGGGCTGCACATGCATCTAGG + Intronic
977462548 4:97342998-97343020 CACAATCTGCACATGTATCCTGG + Intronic
977625155 4:99181935-99181957 CACATTCTGCACATGTATCCCGG - Intergenic
978328404 4:107585313-107585335 CACATTCTGCACATGTATCCTGG + Intergenic
978569838 4:110124682-110124704 TACATTCTGCACATGTATCCTGG + Intronic
980758319 4:137193990-137194012 ATCAGTCTGCCCCTGTAACATGG - Intergenic
981383881 4:144104435-144104457 CACATTCTGCACATGTATCCTGG - Intergenic
981894939 4:149787258-149787280 CACATTCTGCACATGTATCCTGG + Intergenic
981919737 4:150074727-150074749 CACATTCTGCACATGTATCCTGG - Intergenic
982626410 4:157771946-157771968 CACATTCTGCACATGTATCCCGG + Intergenic
982747234 4:159116999-159117021 CACATTCTGCACATGTATCCTGG + Intronic
982846562 4:160260118-160260140 CACATTCTGCACATGTATCCTGG - Intergenic
982978003 4:162091448-162091470 CTCAGTCTGAACAAGTGTCTGGG + Intronic
983213480 4:164980909-164980931 CACATTCTGCACATGTATCCCGG + Intergenic
983381274 4:166997286-166997308 CACATTCTGCACATGTATCCCGG + Intronic
983387702 4:167086485-167086507 ATGAGTCTGAACATGGTTCTGGG + Intronic
983965427 4:173803950-173803972 CACATCCTGCACATGTATCTTGG - Intergenic
983971835 4:173885103-173885125 CACATTCTGCACATGTATCCTGG - Intergenic
984187226 4:176560836-176560858 CACATTCTGCACATGTATCCTGG - Intergenic
984375952 4:178929472-178929494 ATCAATGTTCACATGTAGCTAGG - Intergenic
984964193 4:185126967-185126989 ACAAACCTGCACATGTATCTCGG - Intergenic
985066123 4:186124135-186124157 ATTATTCTGTAGATGTATCTTGG - Intronic
986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG + Intergenic
987190840 5:15476494-15476516 CACATTCTGCACATGTATCCTGG + Intergenic
987676287 5:21076663-21076685 ATCAATCTACACATTTATTTTGG - Intergenic
988735995 5:34021894-34021916 CACATTCTGCACATGTATCCTGG + Intronic
991329803 5:65481924-65481946 GTCAGTCTGCAGATGTGCCTGGG + Intergenic
992023667 5:72650189-72650211 CACATTCTGCACATGTATCCTGG - Intergenic
992055329 5:72983235-72983257 CACATTCTGCACATGTATCCCGG - Intronic
992390181 5:76323979-76324001 CACGTTCTGCACATGTATCTCGG + Intronic
992932296 5:81661136-81661158 AACATTCTGCACATGTATCCTGG + Intronic
992977149 5:82132278-82132300 CACATTCTGCACATGTATCCCGG - Intronic
993085158 5:83355000-83355022 AAAAGTCTGCACCTGTACCTTGG + Intergenic
993116759 5:83728326-83728348 CACATTCTGCACATGTATCCCGG + Intergenic
993286226 5:86000781-86000803 CACATTCTGCACATGTATCCTGG + Intergenic
994279573 5:97885629-97885651 AGCAGTCAGCACATGGATCTTGG + Intergenic
994422746 5:99542116-99542138 ATCAGTCTGCATAATTACCTTGG - Intergenic
994459628 5:100055391-100055413 ATCAGTCTGCATAATTACCTTGG + Intergenic
995081354 5:108054202-108054224 CACATTCTGCACATGTATCCCGG + Intronic
995379461 5:111515962-111515984 AACATCCTGCACATGTATCCTGG + Intergenic
995593464 5:113724017-113724039 CACATTCTGCACATGTATCCCGG - Intergenic
996117841 5:119637722-119637744 CACAGCCTGCACATGTATCCTGG - Intergenic
996495615 5:124151660-124151682 CACATTCTGCACATGTATCCTGG + Intergenic
996917381 5:128728719-128728741 CACATTCTGCACATGTATCCTGG - Intronic
997097990 5:130935136-130935158 CACATTCTGCACATGTATCCTGG + Intergenic
997127136 5:131238580-131238602 CACAATCTGCACATGTATCCCGG + Intergenic
998277652 5:140773438-140773460 CACATTCTGCACATGTATCGTGG - Intergenic
998702923 5:144725132-144725154 CACATTCTGCACATGTATCCTGG + Intergenic
998859775 5:146431055-146431077 ACAAATCTGCACATGTATCCTGG - Intergenic
1000474115 5:161684047-161684069 CACATTCTGCACATGTATCCTGG + Intronic
1000886349 5:166752151-166752173 CACATTCTGCACATGTATCCTGG - Intergenic
1001823433 5:174727020-174727042 CACATTCTGCACATGTATCCCGG + Intronic
1002554223 5:180021938-180021960 GTCAGTCTGCAACTGTCTCTCGG + Intronic
1003144427 6:3498019-3498041 TTCAGTTTCTACATGTATCTTGG - Intergenic
1003253735 6:4456519-4456541 ATCTGTCAGCACATTGATCTTGG - Intergenic
1003472039 6:6445813-6445835 CACATTCTGCACATGTATCCTGG - Intergenic
1003818400 6:9867509-9867531 CACATTCTGCACATGTATCCTGG - Intronic
1003981578 6:11395159-11395181 CACATTCTGCACATGTATCTTGG + Intergenic
1004826630 6:19428986-19429008 CACATTCTGCACATGTATCCTGG - Intergenic
1006032740 6:31189231-31189253 CACATTCTGCACATGTATCCTGG - Intergenic
1006301237 6:33194479-33194501 ACCAGTCCTCACAGGTATCTGGG + Exonic
1009280593 6:61746093-61746115 CACATTCTGCACATGTATCCCGG - Intronic
1009552846 6:65121209-65121231 ATCAATGTGCACAAGTGTCTTGG - Intronic
1009676101 6:66823109-66823131 CACATTCTGCAAATGTATCTCGG + Intergenic
1010473188 6:76254559-76254581 CACATTCTGCACATGTATCCCGG - Intergenic
1010914751 6:81602388-81602410 CACATTCTGCACATGTATCCTGG - Intronic
1011535060 6:88367861-88367883 TTCTGTCTGCAAATGTATTTAGG + Intergenic
1011944698 6:92886174-92886196 CACCTTCTGCACATGTATCTTGG + Intergenic
1011973018 6:93252463-93252485 AGCAGTTTCCACATGTATCAGGG + Intronic
1011992040 6:93533997-93534019 CACATTCTGCACATGTATCCTGG - Intergenic
1012096131 6:94964623-94964645 CACATTCTGCACATGTATCCTGG - Intergenic
1012342946 6:98151462-98151484 CACATTCTGCACATGTTTCTTGG - Intergenic
1013576977 6:111493620-111493642 CACATTCTGCACATGTATCCCGG - Intergenic
1014065211 6:117116698-117116720 CACATTCTGCACATGTATCCTGG + Intergenic
1014465408 6:121750739-121750761 CACATTCTGCACATGTATCCTGG - Intergenic
1014794489 6:125708401-125708423 ATATGTATTCACATGTATCTTGG - Intergenic
1015293505 6:131564126-131564148 ATACGTCTGCACATGCATCTTGG - Intergenic
1015410735 6:132891260-132891282 CACATTCTGCACATGTATCCCGG + Intergenic
1015619872 6:135119963-135119985 CACATTCTGCACATGTATCCTGG - Intergenic
1016768641 6:147823589-147823611 CACATTCTGCACATGTATCCTGG + Intergenic
1017619427 6:156280594-156280616 AACACTCTGCACATGTATCCCGG + Intergenic
1017808679 6:157968041-157968063 CACATTCTGCACATGTATCCTGG - Intergenic
1018010728 6:159667497-159667519 ATCAGTCTGAACATGGATATGGG - Intergenic
1018226619 6:161635391-161635413 ATCTGTCAGCACATGTAAATAGG - Intronic
1018749242 6:166788815-166788837 CACATTCTGCACATGTATCCTGG + Intronic
1019100109 6:169623332-169623354 ATCAGTCTCCCCAGGAATCTGGG - Intronic
1020458844 7:8405385-8405407 CACATTCTGCACATGTATCGCGG - Intergenic
1021312347 7:19110331-19110353 ATCAAACTGATCATGTATCTTGG + Intronic
1021425358 7:20493999-20494021 ATCTGTCTCCACATTTTTCTAGG + Intergenic
1022872834 7:34497430-34497452 CACATTCTGCACATGTATCCTGG - Intergenic
1023032912 7:36106694-36106716 ATCAGTCTTAAAATGTCTCTGGG - Intergenic
1023648747 7:42346409-42346431 GTCAGTGTGTACATGTATTTAGG - Intergenic
1026384280 7:69830369-69830391 TACATTCTGCACATGTATCCTGG + Intronic
1026604050 7:71800831-71800853 CACATTCTGCACATGTATCATGG - Intronic
1029175709 7:98662928-98662950 CGCATTCTGCACATGTATCCCGG - Intergenic
1029888710 7:103903865-103903887 CACATTCTGCACATGTATCCCGG - Intronic
1030446614 7:109653373-109653395 CACATTCTGCACATGTATCCCGG - Intergenic
1031268197 7:119609522-119609544 CACATTCTGCACATGTATCCCGG + Intergenic
1031620959 7:123933082-123933104 CACATTCTGCACATGTATCCTGG - Intronic
1031834794 7:126669297-126669319 CACATTCTGCACATGTATCCTGG + Intronic
1032260116 7:130328926-130328948 AACATTCTGCACATGTATCCTGG + Intergenic
1032937588 7:136751061-136751083 CACATTCTGCACATGTATCCAGG - Intergenic
1032978718 7:137256216-137256238 CACATTCTGCACATGTATCTTGG - Intronic
1033433431 7:141310437-141310459 ACCATTCTACACATGTATCTTGG - Intronic
1033622635 7:143076015-143076037 GTCTTTCTGCACATGGATCTGGG - Intergenic
1034048179 7:147951899-147951921 CACATTCTGCACATGTATCCCGG + Intronic
1034140843 7:148814469-148814491 ATGAGACTGCACATGAAGCTTGG - Intronic
1035827792 8:2663171-2663193 CATATTCTGCACATGTATCTCGG - Intergenic
1035907031 8:3523542-3523564 ATCTGTGTGCACATGTGTCTGGG - Intronic
1036161504 8:6393117-6393139 ATCAGCCAGCACATTGATCTTGG + Intergenic
1036202635 8:6782027-6782049 CACATTCTGCACATGTATCCAGG - Intergenic
1036475212 8:9087061-9087083 CACATTCTGCACATGTATCCTGG - Intronic
1039251576 8:35670839-35670861 CACATTCTGCACATGTATCCTGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039762981 8:40598225-40598247 CACATTCTGCACATGTATCCTGG - Intronic
1039830949 8:41213865-41213887 CACATTCTGCACATGTATCCCGG + Intergenic
1040710742 8:50185857-50185879 CACTTTCTGCACATGTATCTTGG - Intronic
1040896897 8:52377337-52377359 ATCAGTCACCACATAGATCTAGG - Intronic
1041008611 8:53519698-53519720 CACATTCTGCACATGTATCCTGG + Intergenic
1042274434 8:66988420-66988442 ATCAGTCTGTCCCTGTATTTTGG + Exonic
1042381950 8:68126284-68126306 AACAGTCTTCACCTGTATATAGG + Intronic
1042654762 8:71083851-71083873 ATCAGCCTGCACATGTAACCTGG + Intergenic
1043109865 8:76167533-76167555 CACATTCTGCACGTGTATCTCGG + Intergenic
1045811923 8:106231745-106231767 TCCAATCTGCACATGGATCTAGG + Intergenic
1045997791 8:108383706-108383728 CACATTCTGCACATGTATCCTGG - Intronic
1046254052 8:111673280-111673302 AACATTCTGCACAGGTATCCTGG - Intergenic
1046411541 8:113849847-113849869 ATCATTCTGGACATGAATCTTGG + Intergenic
1046943332 8:119952478-119952500 CACGTTCTGCACATGTATCTTGG - Intronic
1048373248 8:133798885-133798907 TACATTCTGCACATGTATCCCGG + Intergenic
1048629832 8:136230405-136230427 CACATTCTGCACATGTATCCCGG - Intergenic
1050411444 9:5370042-5370064 CACATTCTGCACATGTATCCCGG + Intronic
1050871659 9:10578934-10578956 CACATTCTGCACATGTATCCCGG - Intronic
1051294650 9:15582894-15582916 CACATTCTGCACATGTATCTCGG + Intronic
1051769595 9:20562644-20562666 ATAAAATTGCACATGTATCTGGG - Intronic
1051943335 9:22535388-22535410 TTCCGTCTGAACATATATCTGGG + Intergenic
1052071802 9:24090792-24090814 GTCAGTCTGCACATTAATATTGG + Intergenic
1052433835 9:28401187-28401209 TACAGTCTGCACATTTATCTCGG - Intronic
1052600209 9:30617757-30617779 ATCAGTTTGCAAATATCTCTTGG - Intergenic
1053511955 9:38695177-38695199 TACATTCTGCACATGTATCCTGG + Intergenic
1055600001 9:77906060-77906082 CACATTCTGCACATGTATCCCGG + Intronic
1056015437 9:82381290-82381312 CACATTCTGTACATGTATCTTGG + Intergenic
1056244755 9:84683202-84683224 TACATTCTGCACATGTATCCCGG - Intronic
1056652568 9:88480266-88480288 CACATTCTGCACATGTATCCCGG + Intergenic
1056872930 9:90301878-90301900 CACAATCTGCACATGTATCCTGG - Intergenic
1057158574 9:92867591-92867613 CACATTCTGCACATGTATCCTGG + Intronic
1057958141 9:99428595-99428617 ATAATTCTGCATATGTATATAGG + Intergenic
1058391537 9:104501049-104501071 AACATTCTGCACGTGTATCCTGG - Intergenic
1058447527 9:105067002-105067024 CTCAGTGTGCACCTGTTTCTTGG - Intergenic
1058690792 9:107518983-107519005 AACATTCTGCACATGTATCCCGG - Intergenic
1058829706 9:108805035-108805057 CACATTCTGCACATGTATCCTGG + Intergenic
1185835452 X:3342331-3342353 TACACTCTGCACATGTATCTTGG + Intronic
1185872810 X:3678630-3678652 ATCAGACTGCAGAAGTATGTCGG + Intronic
1186115654 X:6302898-6302920 CACATTCTGCACATGTATCTGGG - Intergenic
1186329235 X:8514552-8514574 ATAAGTCTGCACTTGTACATTGG - Intergenic
1186766383 X:12774555-12774577 CACATTCTGCACATGTATCTCGG + Intergenic
1186912825 X:14187655-14187677 CACATTCTGCACATGTATCCTGG - Intergenic
1187634134 X:21207924-21207946 ACCAACCTGCACATGTATCCTGG + Intergenic
1188243340 X:27814102-27814124 CACATTCTGCACATGTATCCAGG - Intronic
1188546471 X:31313044-31313066 CACGTTCTGCACATGTATCTCGG + Intronic
1188739081 X:33755218-33755240 ACAAGCCTGCACATGTACCTTGG + Intergenic
1188750555 X:33900069-33900091 ATCAGTCTGAACATGATTTTGGG - Intergenic
1188923784 X:36012794-36012816 CACATTCTGCACATGTATCCTGG + Intergenic
1190126589 X:47710818-47710840 CACAGCCTGCACATGTATCCCGG + Intergenic
1191000070 X:55650271-55650293 CACATTCTGCACATGTATCCTGG + Intergenic
1191040309 X:56070749-56070771 CACGTTCTGCACATGTATCTTGG + Intergenic
1192886812 X:75344196-75344218 CACATTCTGCACATGTATCCTGG - Intergenic
1194209744 X:91057127-91057149 CACATTCTGCACATGTATCCTGG + Intergenic
1194282184 X:91966835-91966857 CACGGTCTGCACATGTATCCTGG - Intronic
1194363175 X:92979790-92979812 CACATTCTGCACATGTATCCTGG + Intergenic
1194708695 X:97206284-97206306 CACATTCTGCACATGTATCCTGG + Intronic
1194973041 X:100365177-100365199 AACAGTCTGCAGATGTATATAGG + Intronic
1195685673 X:107583138-107583160 CACATTCTGCACATGTATCCCGG - Intronic
1195718670 X:107843982-107844004 ATCATTCTTCCCCTGTATCTAGG + Intronic
1196609995 X:117701788-117701810 ATAGGACTGCAGATGTATCTTGG - Intergenic
1196635336 X:117995460-117995482 CACATTCTGCACATGTATCCTGG - Intronic
1196676862 X:118429172-118429194 CACATTCTGCACATGTATCTTGG + Intronic
1196963512 X:121030090-121030112 ATCAGTCTCCCCAAGCATCTGGG + Intergenic
1197319722 X:125012314-125012336 CTCATTCTGCACATGTATCCTGG + Intergenic
1198644076 X:138787570-138787592 CACATTCTGTACATGTATCTGGG - Intronic
1198755594 X:139978890-139978912 CACATTCTGCACATGTATCCTGG + Intergenic
1198833587 X:140777270-140777292 CACGTTCTGCACATGTATCTTGG + Intergenic
1198885788 X:141334602-141334624 ATCTGTCTGCACCTTGATCTTGG + Intergenic
1199066251 X:143422232-143422254 CACATTCTGCACATGTATCCTGG - Intergenic
1199127588 X:144141055-144141077 CACATTCTGCACATGTACCTCGG + Intergenic
1199409107 X:147499167-147499189 CACATTCTGCACATGTATCCAGG - Intergenic
1199477968 X:148267200-148267222 CACATTCTGCACATGTATCCAGG - Intergenic
1200599775 Y:5191490-5191512 CACGGTCTGCACATGTATCCTGG - Intronic
1201241231 Y:11958683-11958705 TACACTCTGCACATGTATCGTGG - Intergenic
1201481305 Y:14442184-14442206 AACATTCTGCACATGTATCGTGG + Intergenic
1201980170 Y:19898709-19898731 CACATTCTGCACATGTATCCAGG + Intergenic