ID: 1099713901

View in Genome Browser
Species Human (GRCh38)
Location 12:86265240-86265262
Sequence GCAGCCTGCCAGGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099713893_1099713901 29 Left 1099713893 12:86265188-86265210 CCTGGCTCACCCATGTCAGGTGT 0: 1
1: 2
2: 38
3: 103
4: 284
Right 1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1099713895_1099713901 19 Left 1099713895 12:86265198-86265220 CCATGTCAGGTGTGACATCCAGG 0: 1
1: 0
2: 8
3: 80
4: 266
Right 1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1099713894_1099713901 20 Left 1099713894 12:86265197-86265219 CCCATGTCAGGTGTGACATCCAG 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1099713898_1099713901 -4 Left 1099713898 12:86265221-86265243 CCAGTAGCGCGAGCCAAGCGCAG 0: 1
1: 0
2: 21
3: 68
4: 167
Right 1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1099713897_1099713901 1 Left 1099713897 12:86265216-86265238 CCAGGCCAGTAGCGCGAGCCAAG 0: 1
1: 3
2: 45
3: 99
4: 181
Right 1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG 0: 1
1: 0
2: 0
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099713901 Original CRISPR GCAGCCTGCCAGGCCAAAAC AGG Intronic
900079562 1:845400-845422 GCAGCCTGCAAGCCCCAACCTGG - Intergenic
900296736 1:1955663-1955685 CCAGGCTGCCAGGCCAAGCCAGG - Intronic
901629650 1:10641919-10641941 GCAGCCAGCCAGGCCAAGGACGG - Intronic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
904312629 1:29639116-29639138 CCAGCCTGCCAGGCGATGACGGG - Intergenic
906146292 1:43562656-43562678 GCACTCTGGGAGGCCAAAACGGG - Intronic
911041468 1:93594306-93594328 GCAGCATGCCCAGCGAAAACAGG - Intronic
912467279 1:109882766-109882788 CCCGCCTGCCAGGCCAACAGAGG - Intergenic
913686624 1:121238162-121238184 GCTGCCTGCCAGGTAAAATCTGG + Intronic
914038478 1:144025802-144025824 GCTGCCTGCCAGGTAAAATCTGG + Intergenic
914150977 1:145042106-145042128 GCTGCCTGCCAGGTAAAATCTGG - Intronic
914937226 1:151992386-151992408 GCAGGCTGCCAGGCGCATACTGG + Intronic
915100858 1:153498888-153498910 GAAGCTTGCCAGGCCATAAATGG - Intergenic
919788496 1:201275357-201275379 GCAGCCTGCCAGGCCACGGACGG - Intergenic
920230392 1:204466209-204466231 GCAGCCTGGGAGGCCACACCAGG + Intronic
920473950 1:206256720-206256742 GCTGCCTGCCAGGTAAAATCTGG + Intronic
922882251 1:228989888-228989910 GCAGTGTGCCAGGCCCAAGCTGG + Intergenic
924469213 1:244325102-244325124 GCAGCCTCCCAGGCCAGAGCAGG + Intergenic
924817467 1:247455329-247455351 GCAGCCTCCCATCCCACAACCGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1066620689 10:37345874-37345896 GCAGCCTGTGTGGCCAAGACTGG - Intronic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1068358275 10:55940911-55940933 GCAGCCTCCCAAGCCAGAGCTGG + Intergenic
1069550173 10:69358613-69358635 GCACCCTGGGAGGCCAAAGCGGG + Intronic
1070108349 10:73458553-73458575 GCACCCTGGGAGGCCAAAGCGGG + Intronic
1071260706 10:83916444-83916466 GCAGCCTGCCAGGAGAGGACTGG + Intergenic
1072070041 10:91907607-91907629 GAAGCCTCACAGGTCAAAACTGG - Exonic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073374097 10:103017983-103018005 GCAAGCCGCCAGGCCAAAATCGG + Intronic
1074908116 10:117882825-117882847 GCAGCTTGGGAGGCCAAGACAGG + Intergenic
1076104815 10:127813227-127813249 GCAGCATGACAGGCCAGCACTGG + Intergenic
1077279409 11:1735331-1735353 GGAGGCTGCCAGGGCAGAACTGG + Exonic
1078154489 11:8787461-8787483 CCATCATGCCAGGCCAGAACTGG + Intronic
1078300736 11:10129755-10129777 GCAGTTTGGGAGGCCAAAACAGG + Intronic
1081716844 11:45256474-45256496 GGAGCCAGCCATGCAAAAACAGG - Intronic
1083010187 11:59389358-59389380 GCAGCCTGCATGGCCAGGACTGG - Intergenic
1083165109 11:60879935-60879957 CCAGCCTGCCAGGGACAAACAGG - Intergenic
1083341406 11:61960738-61960760 GCAGGCAGCCAGGCCATCACAGG + Intronic
1083555759 11:63625739-63625761 GCACCCTGGAAGGCCAAGACAGG + Exonic
1083667633 11:64284517-64284539 GCTCCCTGCCAGGCCAGACCCGG - Exonic
1083834131 11:65253398-65253420 CCATCATGCCAGGCCAAAAAGGG + Intergenic
1084045335 11:66564779-66564801 GCAGCCTGGCTGGCCAAGAGAGG - Exonic
1084529643 11:69719281-69719303 CAAGCCTGCCAGGCCAAGAGGGG - Intergenic
1085054963 11:73398082-73398104 GAAGCCTGGCAGGCCATAGCTGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085720235 11:78905974-78905996 GCAGCCTGAAAGGCCAAGGCTGG - Intronic
1086042254 11:82493802-82493824 GCAGCCTCCCAAGCCAGAATAGG - Intergenic
1086833415 11:91593682-91593704 GCAGCCTGCATGGCCAGGACAGG - Intergenic
1088741253 11:112769330-112769352 GCTGCATGCCAGGGCAGAACTGG - Intergenic
1089174826 11:116540812-116540834 GGAGCCTGCCAGGCCCAAAGGGG + Intergenic
1091736726 12:2928653-2928675 CCAACATGCCAGGCCAACACTGG - Intronic
1092137710 12:6161200-6161222 CCAGCCTGCAAGGCAAAAATGGG + Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1098454308 12:70654889-70654911 GCACTTTGGCAGGCCAAAACAGG - Intronic
1098983269 12:76983172-76983194 GAAGCCTTCCAGGTCAAAAGAGG - Intergenic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1103624990 12:122211460-122211482 GCACTCTGGCAGGCCAAGACGGG + Intronic
1103726080 12:122997972-122997994 GCAGCCCCCAAGGCCAAGACAGG - Intronic
1104942761 12:132402624-132402646 GCAGCCTGTGAGGCCACATCAGG - Intergenic
1105024241 12:132838061-132838083 CCAGCCTGCCAGCCCGAAGCTGG + Intronic
1105030896 12:132882946-132882968 GCAGTTTGGGAGGCCAAAACAGG - Intronic
1105316184 13:19266188-19266210 GCCACCAGCCAGGACAAAACTGG - Intergenic
1106610796 13:31278660-31278682 GTAGCCTGCCAAGCCACCACTGG + Intronic
1110371583 13:74747035-74747057 GCAGCCTGCATTGCCAAAATTGG + Intergenic
1112254748 13:97819661-97819683 GGACCCTGCAAGGCCAAAGCTGG + Intergenic
1114507290 14:23226887-23226909 GCAGTCTGAGAGGCCAAACCCGG - Intronic
1114849872 14:26371101-26371123 CCAGCCTGTCAGGAAAAAACAGG - Intergenic
1117973807 14:61279324-61279346 GCAGAGTGCCAGACCAAACCTGG + Exonic
1118283093 14:64447037-64447059 GCAGCCTGCCTGGGCAACATAGG - Intronic
1118826436 14:69387359-69387381 CCAGCCTGCCTGGGCAACACAGG + Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1120974483 14:90236566-90236588 GCACTCTGCGAGGCCAAGACAGG - Intergenic
1122432551 14:101664492-101664514 GCACCTTGCGAGGCCAAGACAGG - Intergenic
1124925713 15:34068451-34068473 GCACTTTGCCAGGCCAAATCGGG - Intergenic
1128502903 15:68241192-68241214 GGAGACTTCCAGTCCAAAACTGG + Intronic
1129061160 15:72861358-72861380 TCAGCCTCCCAGGCAAAAATGGG + Intergenic
1129701440 15:77770809-77770831 GCAGCCTGCCAGGCCAGGCTGGG - Intronic
1129979148 15:79850555-79850577 GCAGCCCCACAGGCCAAATCTGG - Intronic
1130548408 15:84873128-84873150 GCAGCCTCCCAGGCCTAGAGAGG + Exonic
1132892709 16:2212144-2212166 GCACCCTGTCAGGCCAGACCCGG + Exonic
1133196931 16:4177619-4177641 GCAGTCTGGGAGGCCAAGACGGG + Intergenic
1133910956 16:10066162-10066184 GCAGCCTCCCACTCCAACACCGG - Intronic
1134970750 16:18528706-18528728 GCACTCTGCGAGGCCAACACAGG + Intronic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1139151091 16:64382253-64382275 GCTGCCTGCCAGGCCAAGTGGGG + Intergenic
1140381063 16:74488293-74488315 GCAGTTTGGGAGGCCAAAACGGG + Intronic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1144523945 17:15973969-15973991 GCAGCCTGCTGAGCCAAAGCAGG + Intronic
1144574186 17:16418559-16418581 CTAGCCTGCGAGGCCAAAGCTGG - Intronic
1144958454 17:19031518-19031540 GCAGCCTTCCAGGCCAGGAGGGG + Intronic
1144976705 17:19143006-19143028 GCAGCCTTCCAGGCCAGGAGGGG - Intronic
1145216948 17:21060010-21060032 ACTGCCTGCCTGGCCATAACCGG - Intergenic
1149756075 17:59187076-59187098 GCAGTTTGGGAGGCCAAAACAGG + Intronic
1151311224 17:73293502-73293524 GTGGCCTGCCAGGCAAAACCTGG - Intronic
1151610860 17:75173786-75173808 CCACCCTGCTAGGACAAAACTGG + Intergenic
1151766314 17:76135196-76135218 CCAGCCTGTCAGTCCAAAGCTGG + Intergenic
1152314354 17:79571717-79571739 GCAGCCGACCTGGCCAAGACTGG + Intergenic
1152341130 17:79725711-79725733 GCACTTTGCAAGGCCAAAACGGG + Intergenic
1152774724 17:82193922-82193944 GCAGCCTCGCAGGCCAGGACTGG - Intronic
1153750236 18:8222040-8222062 GCAGCCTCCCAAGCCAAAGTAGG - Intronic
1154500362 18:14992979-14993001 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG + Intergenic
1155936627 18:31761366-31761388 GCACCTTGGGAGGCCAAAACGGG + Intergenic
1163113808 19:15177738-15177760 GCCGCCTGCCAGGCCAAGCGCGG - Exonic
1163298637 19:16429376-16429398 ACTGCCTGCCAGGCCAACGCTGG + Intronic
1163848645 19:19651337-19651359 GCAGCTTGCCGGGCCAAAGAGGG + Intronic
1164273472 19:23695154-23695176 GCAGCTTGGGAGGCCAAGACTGG + Intergenic
1166127751 19:40725855-40725877 GCACTTTGGCAGGCCAAAACAGG + Intronic
1166520153 19:43474859-43474881 GCAGCCGGTCAGGCCAGAAAGGG + Intergenic
1166730286 19:45055497-45055519 GCAGGCTGGCAGGCCAGAAGGGG - Intronic
925171973 2:1755488-1755510 ACAGCCCTCCAGGCAAAAACAGG + Intergenic
926108719 2:10168656-10168678 GGAGCCGGCCAGGCCAGAGCCGG - Intronic
927357435 2:22189131-22189153 GAATCCTGCCAGGCCAAGGCAGG + Intergenic
929701120 2:44163934-44163956 ACAGCCTAGGAGGCCAAAACTGG - Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
931187974 2:59972171-59972193 GCAGCCTGGCAGGCAAGAACAGG + Intergenic
931393839 2:61868268-61868290 GCAGCCTCCCAAGCCAAAGTAGG + Exonic
932644497 2:73487176-73487198 ACAGCCTGCCAGGCCAAGTGCGG - Intronic
935250694 2:101257498-101257520 GCAGCCTGGCAGTCAAAGACAGG - Intronic
935807496 2:106763335-106763357 GCAGCCAGCCAGCCCCAAGCAGG - Intergenic
936957333 2:118035815-118035837 GCATCCTGGGAGGCCAAAACAGG - Intergenic
938499565 2:131823324-131823346 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
938648062 2:133351715-133351737 GCAGCAATCCAGGCCAAACCTGG + Intronic
940499444 2:154475994-154476016 GCAGCCTCCTGAGCCAAAACAGG + Intergenic
940719018 2:157261183-157261205 GCAGCCTGCCAGGTCAATAAGGG - Intronic
946229068 2:218280451-218280473 GCAGCCAGCCAGGGCAGAACAGG + Intronic
947592598 2:231394118-231394140 GCAGGCAGCCAGGCCAACAGGGG + Intergenic
948236575 2:236395217-236395239 GCAGGTGGCCAGCCCAAAACAGG + Intronic
948741132 2:240046642-240046664 GGAGCCTCCCAGGCCAAGAAGGG + Intergenic
1172032939 20:31994464-31994486 GCACCCTGGGAGGCCAAAGCAGG + Intronic
1173094292 20:40010380-40010402 CAAGCCAGGCAGGCCAAAACTGG - Intergenic
1175994356 20:62805435-62805457 GAAGCCTCCCAGGCCAGACCCGG - Intronic
1176181383 20:63751454-63751476 ACAGCCGGCCAGGCAAACACGGG + Intronic
1177476439 21:21630026-21630048 GAAGCCTGCCAGTCTACAACTGG + Intergenic
1177912748 21:27052719-27052741 GCAGCCTCAAAGACCAAAACTGG + Intergenic
1178800810 21:35793590-35793612 CCACCGTGCCAGGCCACAACAGG + Intronic
1180129993 21:45821178-45821200 CCAGCCTGCCAGGCAAAAAGTGG - Intronic
1180877715 22:19182562-19182584 GCAGCCCTCCAGGCTAAAGCTGG + Intronic
1181118994 22:20652898-20652920 GCAGCCAGCCTGGCCAAGACTGG + Intergenic
1182153460 22:28047694-28047716 GCAGGCTTCCAGCCCAAAGCAGG + Intronic
1184104154 22:42357811-42357833 GCACCATGCCAGGACAGAACGGG - Intergenic
1184578850 22:45398421-45398443 TCAGCCTGCCAGGCCGCACCTGG - Intronic
1185188613 22:49418472-49418494 CCAGCCTGCCCGGCCAGAATAGG - Intronic
950766251 3:15275211-15275233 GCAGCAGGCCAGGCCAAGACAGG + Intronic
954136299 3:48583670-48583692 GCAGCCTCCCACCCCAGAACTGG + Intronic
956910268 3:73809282-73809304 GCAGCTTGCCTGGGCAAGACTGG - Intergenic
959327067 3:104950656-104950678 GCAGCTTGGGAGGCCAAGACAGG + Intergenic
960740014 3:120822901-120822923 GCAGCCTCCCAAGCCAGAATAGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964797330 3:160513509-160513531 GCAGTCTGGGAGGCCAAAGCAGG - Intronic
968555008 4:1242416-1242438 ACTGCCTGCCAGGCCAGAAGGGG + Intronic
968679277 4:1905545-1905567 GCCACCTGCATGGCCAAAACAGG + Intronic
969686087 4:8675061-8675083 GAAACCTGCCAGGCCACAGCTGG + Intergenic
970600484 4:17637762-17637784 GCAGCAAGCCAGGTCCAAACAGG - Intronic
970837762 4:20431435-20431457 GCAGCCTGCCTGGCAAAAGCAGG + Intronic
973261874 4:48173417-48173439 TCAGCCTGAGATGCCAAAACAGG - Intronic
976037602 4:80843228-80843250 CCAGCCTGCCACCCCACAACAGG + Intronic
977419060 4:96774343-96774365 GAAGCCTACCTGGGCAAAACAGG - Intergenic
979735164 4:124073580-124073602 GCAGCCTCGAAGGCCAAAACTGG + Intergenic
980253489 4:130348578-130348600 GCAGCCTGCCAAGCCAAGTGGGG - Intergenic
982107250 4:152021915-152021937 GCCCCCTGCCAGCCCAACACAGG + Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
985665935 5:1181546-1181568 GCAGCCTTCAAGGCCAGGACTGG - Intergenic
986836479 5:11644426-11644448 GCACCCTGGGAGGCCAAGACGGG + Intronic
987055310 5:14185468-14185490 GCAGGCTCCCAGGCCCAGACTGG + Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988073576 5:26324851-26324873 GCTGCCTGCCAGTCCCACACTGG - Intergenic
995748702 5:115431036-115431058 GCAGCCAGCCAGGCCAGCAGTGG - Intergenic
996065626 5:119075809-119075831 GCAGCCTGGGAGGCCAAGGCGGG - Intronic
996124592 5:119709021-119709043 GCAGCCTGCCTGGCCAGGATTGG - Intergenic
996359572 5:122630947-122630969 CCATCCTGCCACCCCAAAACAGG + Intergenic
997355343 5:133259255-133259277 GAAGCCAGCCAGGCCAAGAATGG + Intronic
1001726244 5:173903802-173903824 ACTGCCTGCCAGGGCAAAATGGG - Intronic
1004460339 6:15829276-15829298 GCAGCCTTCCAGGCCAGAGAAGG + Intergenic
1004488870 6:16094719-16094741 GTGGGCTGCCAGACCAAAACTGG + Intergenic
1005821673 6:29604266-29604288 TCCACCTGCCAGGCCAACACTGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1011310208 6:85972874-85972896 CCAGCCTGCCAGCCCATACCCGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1012843483 6:104360713-104360735 GCAGCCTCCTAAGCCAAAATAGG + Intergenic
1014833509 6:126130454-126130476 GCAGGCTGCCCAGCCAGAACGGG + Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1016260470 6:142163499-142163521 GCAGCTTGCCAGTCCTAAAGAGG + Intronic
1018948061 6:168359606-168359628 GCAGCCTCCCGAGCCAGAACAGG - Intergenic
1018984044 6:168622348-168622370 GCAGCCTCCCAAGCCAGAACAGG - Intronic
1022480420 7:30739904-30739926 ACTGCCTGCCAGGCCAAGACAGG + Intronic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1022822770 7:33977410-33977432 GCAGGCTGCCAGGGCAACACTGG - Intronic
1023482321 7:40647074-40647096 GCAGCTTGACAGGGCAAAGCAGG + Intronic
1024840666 7:53583539-53583561 GCAGCCTCCCAAGCCAAAGTAGG - Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1028158580 7:87460239-87460261 GCAGACTCCCAGGCCACATCTGG - Intronic
1029176375 7:98667708-98667730 GCAGCCTGCCACGCCACACAGGG + Intergenic
1030082807 7:105792018-105792040 GCAGCCTGACAGGCCTCGACAGG - Intronic
1031265430 7:119573727-119573749 GCAGCCTGCCAGGCCAAGTGAGG + Intergenic
1032274601 7:130443113-130443135 GGATCCTGCTATGCCAAAACTGG + Intergenic
1035305618 7:157929503-157929525 GCAGCCTGGCAGCCCAACAGAGG + Intronic
1035525942 8:313519-313541 GCAGCCTGCAAGCCCCAACCCGG + Intergenic
1038356095 8:26830829-26830851 GTAGCCTGCCAGAACAAAGCTGG + Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1043299734 8:78712666-78712688 TCAGCCAGCCAGGTCAGAACTGG - Intronic
1044500466 8:92949134-92949156 GAAGCCTCCCAGGCCAGAATAGG - Intronic
1044657631 8:94565017-94565039 CCATCCTGCCAGGCCCAAATTGG - Intergenic
1045084824 8:98670975-98670997 TCAGCCTGCCAGGCCGCATCTGG - Intronic
1046254380 8:111676965-111676987 GCAGCCTGTCAAGCAAAAATAGG - Intergenic
1048085561 8:131174594-131174616 GCAGCCTCCCAAGCCAGAATAGG + Intergenic
1048417751 8:134245516-134245538 GCTACCTGCCAGGTGAAAACTGG - Intergenic
1048890779 8:138944493-138944515 TGAGCCTGCCAGGCCAGATCTGG + Intergenic
1049285690 8:141773972-141773994 GCAGCCTGCCAGGTCAGATATGG - Intergenic
1055256885 9:74382344-74382366 GCAGTTTGGCAGGCCAAAGCAGG + Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055533446 9:77211543-77211565 GCAGCCTCCCAAGCCAGAGCAGG + Intronic
1055576353 9:77663341-77663363 GCAGAATGTCAGACCAAAACAGG - Intergenic
1060170002 9:121453563-121453585 GCAGGGTGCCAGGCCCATACTGG - Intergenic
1060531514 9:124349813-124349835 GCAGCCTGCTAGGCCACTCCCGG - Intronic
1060837877 9:126770724-126770746 CCACCCTGCCCGGCCAAAGCTGG + Intergenic
1062340973 9:136093950-136093972 GGAGCCTGCCAGACGAAAAGAGG + Intronic
1062641561 9:137521184-137521206 GCAGCCTGCAGGGCCAGAAAGGG + Intronic
1185954201 X:4471256-4471278 GCAGTTTGGGAGGCCAAAACAGG + Intergenic
1186248433 X:7639853-7639875 GCAGCCTGAGAGGCCACATCTGG - Intergenic
1192202418 X:69074998-69075020 GCAGCCTGACTGGCTCAAACTGG + Intergenic
1192329308 X:70161854-70161876 GCACCCTCACAGCCCAAAACTGG + Intronic