ID: 1099717277

View in Genome Browser
Species Human (GRCh38)
Location 12:86311721-86311743
Sequence GGTTTGATGGGACATGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099717277 Original CRISPR GGTTTGATGGGACATGGATC AGG Intronic
900710880 1:4113000-4113022 GGTTTTCTGGGCCCTGGATCAGG - Intergenic
902216919 1:14940066-14940088 GGTTTGGCAGGCCATGGATCAGG + Intronic
903450664 1:23451784-23451806 GGTTTGGTGGGCCATGGCTTGGG + Intronic
905144707 1:35879101-35879123 GGTTTGGTGGAACATATATCAGG + Intronic
905678282 1:39845791-39845813 GGTCTGCTGGGATATGGTTCTGG - Intronic
907629860 1:56069604-56069626 GGCTTGATGAGAGATGGAGCTGG + Intergenic
907659153 1:56376018-56376040 GCATCAATGGGACATGGATCAGG - Intergenic
909995215 1:82270418-82270440 GGTCTGATGGGAAGTGGAGCAGG - Intergenic
915631663 1:157157418-157157440 GAATTGATGGTCCATGGATCAGG - Intergenic
918585982 1:186188780-186188802 GGTCTGATGGGACATGGAATAGG + Intronic
920053320 1:203176065-203176087 GGTGAGATGGGACATCGAGCAGG + Intergenic
921076068 1:211701100-211701122 AGTTAGATGGGAGATGGATAGGG - Intergenic
923822910 1:237466303-237466325 GGTTTGATGGTACATGCCTGTGG - Intronic
1062814303 10:488492-488514 GTTTTCATGGGACATGGTTTTGG - Intronic
1063806572 10:9651184-9651206 GGTTTGATAAGACATGTATACGG + Intergenic
1066075198 10:31868423-31868445 AGTTTGAGGGGACAAGGATGTGG + Intronic
1066118785 10:32263608-32263630 GGTTTGATGGGTGATGGAGATGG - Intergenic
1068067015 10:52144223-52144245 GGATTTATGGGACAAGGAACTGG + Intronic
1068288473 10:54970681-54970703 GGTAGGATGGAACATGGAGCAGG - Intronic
1069638094 10:69937746-69937768 GGTTTGATGGGCCAGGGGTGTGG + Intronic
1069985426 10:72279732-72279754 GGTGTGATGGCACATGCATGTGG + Intergenic
1073122311 10:101130317-101130339 GGATTGGTGGGACTAGGATCAGG - Intronic
1075906185 10:126083761-126083783 GGTGTGATGGGAGAGGGAGCTGG + Intronic
1080767080 11:35307074-35307096 GTTGTGATGGGCCCTGGATCTGG + Intronic
1084182977 11:67455789-67455811 GGTTAGGTGGGACCTGGATTGGG + Exonic
1085988752 11:81814118-81814140 CCTTTGATGGGACATGGATGAGG + Intergenic
1091322495 11:134661901-134661923 TGTTTGATTGGACATATATCTGG + Intergenic
1093845022 12:23960143-23960165 GGCTTGATTGGACATGGCTGGGG - Intergenic
1094019536 12:25899597-25899619 GGATTGATGAGTCAAGGATCTGG - Intergenic
1097385209 12:58943113-58943135 AGTTTGGTGGGATATGAATCAGG + Intergenic
1099717277 12:86311721-86311743 GGTTTGATGGGACATGGATCAGG + Intronic
1101545761 12:105711111-105711133 GGGGTGATGGGGCATGGATAAGG + Intergenic
1104901635 12:132192503-132192525 GGTTTGGGGTCACATGGATCTGG + Intergenic
1105659548 13:22478596-22478618 GGTTAAATGGGAAATGGGTCTGG - Intergenic
1109867466 13:68284255-68284277 CCTTTGTGGGGACATGGATCTGG + Intergenic
1118718717 14:68578758-68578780 TGTTGGAAGGCACATGGATCTGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1121387717 14:93544084-93544106 GGATTGATGTGACATGCTTCTGG + Intronic
1121439167 14:93937970-93937992 GTGTTGAGGGGACATGGTTCAGG - Intronic
1121738703 14:96236491-96236513 TGCTTGATTGGACATGGATGGGG - Intronic
1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG + Intergenic
1134341519 16:13351181-13351203 GCTTTGATGTGACAGGGATTTGG - Intergenic
1137441117 16:48499139-48499161 AGTTTGATGGGACATAGACTTGG - Intergenic
1140506637 16:75477765-75477787 GGTTGGAAGGGAAATGGCTCTGG - Exonic
1143091901 17:4453905-4453927 GGTGTGATGGGATGTGGATTTGG - Intronic
1149120371 17:53156282-53156304 GGTTTGATGGGAGGTTGAACAGG - Intergenic
1151922786 17:77170138-77170160 GGTTTGAGGGGAGCTAGATCTGG + Intronic
1152119380 17:78408828-78408850 GGTGTGGTGGGACAAGGTTCTGG + Intronic
1154334568 18:13455412-13455434 GGTTTGATGTGACATCTATGAGG + Intronic
1155813694 18:30274863-30274885 TGTGTGATGGGATAAGGATCAGG - Intergenic
1157732358 18:50015123-50015145 GGGTTCACGGGACAGGGATCAGG + Intronic
1159712643 18:71781382-71781404 TGTTTGATGGTACATATATCTGG + Intronic
1160263547 18:77318362-77318384 GGTCTGTTGGGACATGGACTTGG + Intergenic
1160757076 19:763454-763476 GGTGTGGTAGGACCTGGATCGGG + Intronic
1161654011 19:5502344-5502366 GGTTTTATGGGACAGGAATTTGG - Intergenic
1162415638 19:10535229-10535251 GGCTTGATGGCACATGTCTCTGG - Intergenic
1162959030 19:14115418-14115440 AGTTTGCTGGTAGATGGATCTGG + Intronic
1163888553 19:19990851-19990873 GGTGTGATGGGACACGTTTCTGG - Intergenic
1164159182 19:22615643-22615665 GGTTTTATAGGACATAGAACTGG + Intergenic
1165350355 19:35271881-35271903 GGTCTCATGGGACATTGATGGGG + Intronic
1165431690 19:35776510-35776532 GGGTTGCAGGGACATGGAGCAGG + Intronic
1165644853 19:37426735-37426757 GGTATGGTGGGACATGCAACTGG + Intronic
1166415027 19:42589139-42589161 GGTTGGTTGGGACTTGGCTCAGG - Intronic
1167693515 19:51001359-51001381 GGTCTGAGGGGACAGGGAGCTGG + Intronic
1167736734 19:51299166-51299188 GGTTGGATGGGACGTGGCGCGGG - Intergenic
926624533 2:15080101-15080123 GGTATGATGGGACTTGCTTCTGG - Intergenic
931309696 2:61066233-61066255 GGTCTGCAGGGACATGGACCGGG - Intronic
931790596 2:65660405-65660427 GATTTGATGGGGCATTCATCAGG + Intergenic
932122790 2:69116914-69116936 AGTTTGGTGGCTCATGGATCTGG - Intronic
932842436 2:75095954-75095976 GTTTTGTTGTGACAAGGATCTGG + Intronic
937821205 2:126313149-126313171 GGTGTTTGGGGACATGGATCTGG + Intergenic
938909280 2:135871053-135871075 GGTTTGATAAGAAATGGATGAGG + Intronic
940269950 2:151879731-151879753 AGTTTGATGTGACATTGAGCTGG - Intronic
940617393 2:156066359-156066381 GGGTGGGTGGAACATGGATCAGG - Intergenic
941745447 2:169081913-169081935 GGTAGGATGGGACAGGGATAGGG + Intronic
944326567 2:198412669-198412691 AGTTTGATGGAACAGGAATCTGG + Intronic
947549424 2:231036133-231036155 GGTGTGATGGGACTTGCCTCTGG + Intergenic
1170615100 20:17942011-17942033 GGTTTGTAGGGACATGGGCCAGG + Exonic
1171122179 20:22577383-22577405 GGTCTGATGCGACAGGGAACTGG - Intergenic
1175756315 20:61532687-61532709 GGTTTGATGTGAGGTGGAGCAGG + Intronic
1176418684 21:6496871-6496893 GGTTCCATTGGATATGGATCTGG - Intergenic
1176938552 21:14896282-14896304 GGTGTGAGGGGGCATGGATAAGG - Intergenic
1177504149 21:21999752-21999774 GGTTTAATTGGACATGGCTGGGG + Intergenic
1179694178 21:43105193-43105215 GGTTCCATTGGATATGGATCTGG - Intronic
1182297172 22:29316389-29316411 GCCTTGCTGGGACAGGGATCTGG - Intronic
1182868765 22:33627738-33627760 GGTTAAATGGGTCATGGATGTGG - Intronic
1184274229 22:43401006-43401028 GGTTTGATGGAAGACGGAACTGG + Intergenic
1184524636 22:45014623-45014645 GGTATGATAGGAAATGTATCTGG + Intergenic
951707568 3:25558693-25558715 GGTTTGAGGGGGCATGAATTAGG - Intronic
953197129 3:40745373-40745395 GATTTGATGGGCCCTGGATGGGG - Intergenic
954224764 3:49174462-49174484 GGTTGGCTGGGATAGGGATCAGG + Intronic
955294500 3:57722665-57722687 GGTGTGATGGCACATGGCTATGG - Intergenic
961530253 3:127536213-127536235 GGTTCCAAGGGACATGGAGCAGG - Intergenic
964072939 3:152657042-152657064 TGTTTGCTGGCACATGAATCTGG - Intergenic
965212200 3:165806228-165806250 GGTGTGAGGAGACATGAATCTGG - Intronic
966637010 3:182146644-182146666 GGCTTAAGGGGACAAGGATCTGG - Intergenic
967080313 3:186043724-186043746 GGGTTGAGGGCACATGGAGCTGG - Intergenic
968402591 4:311525-311547 GCTTTGATGGGACTTGGGTAAGG + Intergenic
968843673 4:3027177-3027199 GGTGTGATGGCACATGGCTATGG - Intronic
976639708 4:87325385-87325407 GGTTTGCTGTGACATGTATATGG + Intergenic
978221771 4:106285531-106285553 TCTTTGGTGGGACAGGGATCAGG - Intronic
979707229 4:123734996-123735018 GGTGGGATGGGTCATGGATAAGG + Intergenic
980757422 4:137183771-137183793 AGTTTTATGGGACACGGCTCGGG + Intergenic
981058953 4:140398860-140398882 GGTTTGACGGCAGAAGGATCAGG + Exonic
984058465 4:174960776-174960798 GGTTTGATGAGACCTAGTTCAGG - Intronic
985574068 5:665613-665635 GGTCTGAAGGGGCATGGATTGGG - Intronic
987464184 5:18252748-18252770 GGTTTGATGGGCCTGGGCTCAGG + Intergenic
988735602 5:34017549-34017571 GGTATGATGGGACATTGACTAGG - Intronic
991632528 5:68670714-68670736 GGTTTGGTGTCAGATGGATCTGG + Intergenic
991999819 5:72425170-72425192 GATTTCCTGGAACATGGATCTGG - Intergenic
995128304 5:108602386-108602408 GGTTTGCTGGGACATGGGGAGGG + Intergenic
997248804 5:132373277-132373299 GCTTTGATGCCACATGGATGTGG + Intronic
997355876 5:133262788-133262810 GGAGTGATGTGACACGGATCTGG - Intronic
999113379 5:149141387-149141409 GGTGTGATGGGAGATGGACGAGG - Intergenic
1004125849 6:12872794-12872816 GGGTTGATGGCACAAGGATTTGG - Intronic
1005252985 6:23968749-23968771 GCTTTGAAGTGAAATGGATCAGG - Intergenic
1009291279 6:61885955-61885977 GGTTTGATGGCAAATGCATTTGG - Intronic
1010665602 6:78626234-78626256 TCTGTGATGGGACATGGATTTGG - Intergenic
1011552117 6:88539474-88539496 GGTCTGCTTAGACATGGATCAGG - Intergenic
1016548332 6:145248843-145248865 CGTTTGATGGGGCAAGGATGAGG - Intergenic
1021293040 7:18869226-18869248 GATTTGGTGGGACACAGATCCGG - Intronic
1023678949 7:42663905-42663927 GGTGTGGTGGGACATGAATATGG - Intergenic
1026585698 7:71654333-71654355 GGTTTTATGGGAGAGGGATATGG + Intronic
1028314801 7:89387284-89387306 GGTTTGCTAGTATATGGATCAGG + Intergenic
1029645215 7:101850756-101850778 TGTTTTATGAGACATGGATGAGG + Intronic
1030130453 7:106195149-106195171 TGTGTGAGGGGACATGGGTCAGG - Intergenic
1031964591 7:128018510-128018532 GGTTTGGGGGGAAATGAATCTGG + Intronic
1032085017 7:128879368-128879390 GGTGTGAGGGGAGGTGGATCAGG - Intronic
1034935185 7:155194688-155194710 GGTCTGAGGGGCAATGGATCGGG + Intergenic
1042762894 8:72290162-72290184 GGAGTGATGGGAGATGGATTTGG - Intergenic
1047949122 8:129914006-129914028 GATATGATTGGTCATGGATCAGG - Intronic
1048490167 8:134885005-134885027 GGGCTGATGGAACAGGGATCTGG - Intergenic
1048513401 8:135082356-135082378 GATGGGATGGGACATGGATGGGG - Intergenic
1055330202 9:75175745-75175767 GGTTTTGTGGGTCAGGGATCTGG - Intergenic
1056037194 9:82619108-82619130 GGTGTGAGGGGACTTTGATCTGG + Intergenic
1061222455 9:129260116-129260138 GGTGGGAGGGGTCATGGATCCGG - Intergenic
1186700501 X:12084810-12084832 GATTTGATGGCACATGGATTTGG + Intergenic
1187039507 X:15578897-15578919 GATATGATGGGCCATGGAACAGG + Intronic
1187923560 X:24229651-24229673 GGTGTGATGGCACATGTATGTGG - Intergenic
1192099796 X:68252176-68252198 GGTTCGATGGGGCTTGGCTCAGG - Intronic
1194793340 X:98178622-98178644 GCTTTTCTGGGACATGGATATGG + Intergenic
1197092357 X:122554315-122554337 GATTTAATGGGACATAGACCTGG + Intergenic