ID: 1099719573

View in Genome Browser
Species Human (GRCh38)
Location 12:86342943-86342965
Sequence ATGACTGTCTTTACTAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099719573 Original CRISPR ATGACTGTCTTTACTAGATA GGG Intronic
904228620 1:29047161-29047183 TTCAGTGTCTTTATTAGATAAGG + Intronic
907561602 1:55395320-55395342 ATGTATGTCTTTACTAAATATGG + Intergenic
908340908 1:63178112-63178134 ATGTATGTATATACTAGATATGG + Intergenic
909820670 1:80055243-80055265 ATGGCTGTGTTTATTAAATATGG - Intergenic
909950066 1:81708439-81708461 ATGACTGTCTTGACTGAATGAGG + Intronic
912097086 1:106159219-106159241 TTGTCTGTCTTTATTTGATATGG - Intergenic
914974704 1:152350805-152350827 ATGACTTGCTCTACTAGATCTGG + Exonic
916001009 1:160615760-160615782 ATGACTGTCCTTATAAGAGATGG + Intronic
916009281 1:160690195-160690217 TTGTCTGTCTTTATTTGATATGG + Intronic
917578326 1:176348017-176348039 TTGTCTGTCTTCAATAGATAGGG + Intergenic
918541031 1:185633396-185633418 ATACCTGTCTTTATTAGTTAGGG + Intergenic
919155531 1:193760648-193760670 AGGATTGTCTTTACTACAAATGG + Intergenic
919432897 1:197518767-197518789 AAGACTGTTCTTACTAGATTTGG - Intronic
924764845 1:247022780-247022802 ATGCCTGTATTTATTAGAAAAGG + Intergenic
1066328820 10:34394816-34394838 ATGACTATCCATATTAGATATGG - Intronic
1068761384 10:60714220-60714242 TTCAATGTCTTTAATAGATAAGG - Intronic
1068803527 10:61169132-61169154 ATGACTGTTTCTACCACATAAGG + Intergenic
1068850903 10:61739350-61739372 TTGAAAGTATTTACTAGATATGG + Intronic
1069162662 10:65110057-65110079 TTGTCTGTCTTTATTTGATATGG + Intergenic
1071778669 10:88817962-88817984 ATGACAGTTTATTCTAGATATGG + Intronic
1074664468 10:115704031-115704053 CTGACTGTCTTTAATAAATCTGG - Intronic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1082309859 11:50633146-50633168 TTGTCTGTCTTTATTTGATATGG + Intergenic
1082572704 11:54762547-54762569 TTGTCTGTCTTTATTTGATATGG - Intergenic
1087747159 11:101961781-101961803 AAGACTGTCTATACTTGAGAGGG - Exonic
1088482793 11:110311062-110311084 ATGACTGGCTTTGGTAGAGAGGG + Intergenic
1091477469 12:790004-790026 ATGACTGTCTTGACAGGAGATGG + Intronic
1093154721 12:15667897-15667919 ATGGCTTGCTTTACTTGATATGG - Intronic
1093310641 12:17578147-17578169 ATGACTGTTTTTTCTTGTTATGG - Intergenic
1094492751 12:30971157-30971179 TGGACTGCCTTGACTAGATATGG + Intronic
1095839462 12:46676661-46676683 ATGAATGTCTTTACCTGAAAAGG + Intergenic
1097762317 12:63481829-63481851 TTAACTCTCTTTACTACATATGG + Intergenic
1099719573 12:86342943-86342965 ATGACTGTCTTTACTAGATAGGG + Intronic
1099903055 12:88736300-88736322 ATGACTGTATCTAATAGATTGGG + Intergenic
1101501755 12:105310776-105310798 TTGTCTGTCTTTATTTGATATGG - Intronic
1106263874 13:28092371-28092393 TTGACTGTTTTTTTTAGATAGGG + Intronic
1108014413 13:46059263-46059285 ATGACAGTATTTACTTCATAGGG - Intronic
1111197154 13:84889525-84889547 ATGAATTTCTTCACTGGATAAGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118375192 14:65170837-65170859 ATCTCTGTCTTTACTAGCCAAGG - Intergenic
1124915317 15:33964774-33964796 TTGACTGTCTTTAATATATAGGG - Intronic
1125403476 15:39328949-39328971 ATGACTTTCTTAACTTCATAAGG + Intergenic
1127239199 15:57092736-57092758 ATAACTGTTTTTACCAGTTATGG + Intronic
1127888172 15:63222433-63222455 ATGACTGTATTTACAACAGAAGG - Intronic
1127972867 15:63975510-63975532 CTGACTCTATTTACTAGCTATGG - Intronic
1129438636 15:75562523-75562545 ATGATTGTCTTTAAGATATAGGG - Intronic
1130111618 15:80969961-80969983 ATGACAGTATTTACTGCATAGGG + Intronic
1132436668 15:101810979-101811001 ATGACTGTCTTTGAGAGAAAGGG + Intronic
1133660032 16:7907385-7907407 ATGACTGTCTGTATTAGACAGGG - Intergenic
1138171297 16:54852133-54852155 CTCATTGTCTCTACTAGATACGG - Intergenic
1138247382 16:55477951-55477973 TTGATTGTCTTTACTAGTTTAGG + Intronic
1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG + Intergenic
1146791991 17:35756178-35756200 ATGTCTGCCTTTATTAGTTAGGG + Intronic
1148172703 17:45536520-45536542 TTTAATGTTTTTACTAGATAAGG - Intergenic
1148276568 17:46308929-46308951 TTTAATGTTTTTACTAGATAAGG + Intronic
1148298684 17:46526517-46526539 TTTAATGTTTTTACTAGATAAGG + Intronic
1150403908 17:64883440-64883462 TTTAATGTTTTTACTAGATAAGG - Intronic
1153723738 18:7935225-7935247 AGGACTGTCTTTAGTTGCTATGG + Intronic
1163054359 19:14707064-14707086 ATGATTGAATTTACTAGAAATGG + Intronic
1165021522 19:32928256-32928278 GTGACTGTTTTCACTGGATATGG + Intronic
925519611 2:4728593-4728615 ATCAATGTATTTAATAGATATGG - Intergenic
926323396 2:11764698-11764720 ATGACTGCTTTTACTGGAGAAGG - Intronic
927153554 2:20209268-20209290 ATCACTGTCTCTAGCAGATAAGG + Intronic
930979308 2:57503304-57503326 CTGTCTTTCTCTACTAGATATGG - Intergenic
938718376 2:134042360-134042382 TTGAATTTCTTTAATAGATATGG - Intergenic
939002616 2:136753948-136753970 ATGCCTGTATTTAAAAGATAAGG - Intergenic
939293449 2:140224450-140224472 GTTACTGTATTTATTAGATATGG + Intergenic
940753130 2:157650124-157650146 ATGACTCTGTTTACTAGCTGTGG - Intergenic
941467390 2:165844620-165844642 ATAACAGTATTTACTAGTTAAGG - Intergenic
942262270 2:174180581-174180603 ATGACTGTCTTTAGGAAAAAAGG - Intronic
942521417 2:176808181-176808203 ATTACTGTCTTTAGTATATCTGG - Intergenic
943028108 2:182653598-182653620 ATTGCTATCTTTTCTAGATATGG - Intergenic
944634248 2:201659240-201659262 ATTAATCTCTTTGCTAGATATGG + Intronic
945423822 2:209673956-209673978 AGGACTGTCTATTCTAGACAGGG - Intronic
945647951 2:212524033-212524055 ATAACTGTCTTCAATAGCTAGGG - Intronic
947062688 2:226184265-226184287 ATTAATGTCTTTAAAAGATATGG + Intergenic
947193013 2:227529277-227529299 ATGACTTTCTGAACTATATATGG - Intronic
948137613 2:235648567-235648589 ATGACTGTCTTAACTGGAAGAGG - Intronic
1173661238 20:44735369-44735391 ATGCCTGTCTTTATTAGCTAGGG + Intergenic
1174918822 20:54680793-54680815 ACGCTTGTCTTTCCTAGATATGG - Intergenic
1175013050 20:55759401-55759423 AGGTCTGTCGTTACTGGATATGG - Intergenic
949148047 3:727564-727586 ATGACTTTGTTTATTAGATAAGG - Intergenic
950930870 3:16787780-16787802 ATGAATGTCTTTAGAAAATATGG + Intergenic
951369212 3:21824833-21824855 ATGACTGTTTTTACACCATAGGG + Intronic
951829128 3:26904632-26904654 ATGAATGTCTTTAGTAGAGAGGG + Intergenic
952222839 3:31341942-31341964 ATCTTTGTCTTTACTAGATAGGG - Intergenic
952271363 3:31835143-31835165 ATGACTGTCTTTTAAAGTTAAGG - Intronic
952660975 3:35846381-35846403 ACTACTGTCTTTACAAGAAAAGG - Intergenic
955900984 3:63754151-63754173 ATGACTGTCTTATATAGAGAGGG + Intergenic
959115056 3:102166748-102166770 ATAAATTTCTTTATTAGATATGG + Intronic
959381691 3:105648648-105648670 ATTATTGTATTTACTACATAAGG - Intergenic
962823155 3:139072302-139072324 ATGACTGTATTTATTACTTATGG - Intronic
965201191 3:165659632-165659654 ATGACAGTCTTTCCAAAATATGG + Intergenic
967676337 3:192303062-192303084 AGGACTGTTTTTTCTAAATAAGG - Intronic
971519438 4:27530552-27530574 ATGACTGTCTTTAATATCTCTGG + Intergenic
975481578 4:74886442-74886464 CTGTCTGTCTTTACCAGATGAGG - Intergenic
976235253 4:82890299-82890321 ATAACTGTATTTAATCGATAAGG - Intronic
976909376 4:90281630-90281652 ATGAATCACTTTACTACATATGG - Intronic
978354665 4:107858686-107858708 ATGAATGTCTTAACCAGAGAAGG - Intronic
978679320 4:111359711-111359733 ATGACTTTCTCTACTAGAGAGGG + Intergenic
979594315 4:122516955-122516977 TTGAATTTCTTTACTAGATATGG + Intergenic
981157849 4:141461014-141461036 ATGATTGTCTTGACTCAATAGGG + Intergenic
981947564 4:150366259-150366281 ATCACTATCTTTATTAGATTAGG + Intronic
984030129 4:174593896-174593918 ATGACTGTCTTTTCAAGTGATGG - Intergenic
985652491 5:1113404-1113426 ATGACTGGCTTTACTGGAAATGG - Intergenic
989318542 5:40109117-40109139 TTGTCTGTCTTTATTTGATATGG - Intergenic
990534316 5:56704994-56705016 ATGAATGTATTTACCACATATGG - Intergenic
991128777 5:63097427-63097449 AAGCCTGTCTTTGTTAGATAAGG - Intergenic
994633827 5:102319998-102320020 TTGATGGTCTTTACTAGATCTGG + Intergenic
994911856 5:105920176-105920198 ATAACTTTCTTACCTAGATAAGG - Intergenic
1000034727 5:157436811-157436833 ATGACTGTCTTTTCAACAAATGG + Intronic
1000405244 5:160880695-160880717 AAGACTGTCTTTTCAAGAAATGG + Intergenic
1005375951 6:25182428-25182450 ATAACTGTCTTGATTAGAGATGG - Intergenic
1006615309 6:35321999-35322021 ATGACTGTACTTACCATATAGGG + Intergenic
1009402446 6:63273550-63273572 TTGAATGTTTATACTAGATACGG - Intergenic
1010492286 6:76490477-76490499 TTGTCTGTCTTTATTTGATATGG + Intergenic
1012883806 6:104822036-104822058 ATGACTTTCTTTTGTAGAAATGG - Intronic
1015088319 6:129323726-129323748 ATGACTTTCTTTCTTAAATATGG + Intronic
1016755468 6:147680540-147680562 ATTACTATGTTTAATAGATATGG + Intronic
1017850444 6:158300588-158300610 TTGTCTGTCTTTATTTGATATGG + Intronic
1017993552 6:159510745-159510767 ATTACTCTCTTAACTAGACAAGG + Intergenic
1021026601 7:15675609-15675631 ATGAATGTATTTCCTAGATGAGG - Intronic
1021211600 7:17860962-17860984 ATGGCTGTCTTTACAATATTAGG + Intronic
1027885651 7:83901241-83901263 ATGACGGGGTTTTCTAGATATGG - Intergenic
1027929638 7:84515487-84515509 ATGTCTGTGTTCACTATATAAGG + Intergenic
1030425220 7:109368362-109368384 ACGACTGTCTTCACTTGATTAGG + Intergenic
1031059149 7:117029798-117029820 ATGACAGTCTTTTCAAGAAATGG - Intronic
1032308262 7:130756873-130756895 ATGGCAGTCTTTATTAGTTAAGG - Intergenic
1035093677 7:156334602-156334624 CTGAATGTCTTCACTAGATGAGG + Intergenic
1035996129 8:4549526-4549548 ATGACTGTCTTTCTTGGGTAGGG - Intronic
1036107009 8:5852259-5852281 AAGACTGTCTATACCAGATATGG + Intergenic
1036567461 8:9949682-9949704 CTGTCTGTCTTTCCTAAATATGG + Intergenic
1037340899 8:17843897-17843919 CTGACTGCCTTTGCTAAATATGG + Intergenic
1039571816 8:38592957-38592979 ATGACTGTCTTTACTGTGTCAGG - Intergenic
1043111018 8:76182151-76182173 GTGACTATATTAACTAGATAAGG - Intergenic
1045570791 8:103367256-103367278 AGGACTGTCTTGGCTATATATGG + Intergenic
1046264269 8:111811090-111811112 TTGTTTGTCTTTACTAAATAGGG - Intergenic
1048562073 8:135550464-135550486 ATGATTGTCTTTTCAACATATGG - Intronic
1052193574 9:25685032-25685054 ATTAGTGTCTTTACGAGAAAAGG + Intergenic
1053050188 9:34955353-34955375 TTAACTGTCTTTACAAGGTAGGG - Intergenic
1053581165 9:39405881-39405903 ATGACAATCTTGACCAGATATGG - Intergenic
1053845650 9:42233947-42233969 ATGACAATCTTGACCAGATATGG - Intergenic
1054102752 9:60964685-60964707 ATGACAATCTTGACCAGATATGG - Intergenic
1054583608 9:66942177-66942199 ATGACAATCTTGACCAGATATGG + Intergenic
1056433397 9:86551205-86551227 ATGACTGTATTTGCTAAATCTGG + Intergenic
1057784581 9:98076990-98077012 TTGGCTGTCTTTTCCAGATAAGG - Exonic
1059460533 9:114426697-114426719 ATGACTGTTGTTTCTAGATAAGG - Intronic
1191125144 X:56946565-56946587 TTGCCTGTCTTTATTTGATATGG - Intergenic
1194538930 X:95146213-95146235 CTGGCTGTCTTTACCATATATGG - Intergenic
1194700458 X:97107520-97107542 ATAACAGTCTTTACTTTATAAGG + Intronic
1197317698 X:124988392-124988414 TTCAATGTCTTTAATAGATACGG - Intergenic
1200830517 Y:7684850-7684872 AACACTGTCTTTGCTAGATAAGG + Intergenic
1201950761 Y:19561259-19561281 ATGAGTGTCTTTTCTAGAATGGG + Intergenic