ID: 1099720318

View in Genome Browser
Species Human (GRCh38)
Location 12:86353937-86353959
Sequence CAAGGTAATCAAGAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099720314_1099720318 -3 Left 1099720314 12:86353917-86353939 CCTCCGGTATTTAGAGAGTACAA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 339
1099720310_1099720318 24 Left 1099720310 12:86353890-86353912 CCTCATAGCTAGAGTACCAAATC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 339
1099720313_1099720318 8 Left 1099720313 12:86353906-86353928 CCAAATCAAGGCCTCCGGTATTT 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 339
1099720316_1099720318 -6 Left 1099720316 12:86353920-86353942 CCGGTATTTAGAGAGTACAAGGT 0: 1
1: 0
2: 3
3: 21
4: 535
Right 1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG 0: 1
1: 0
2: 1
3: 28
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099720318 Original CRISPR CAAGGTAATCAAGAAGAGGA TGG Intronic
900823187 1:4905752-4905774 CAAAGGAAGCAAGGAGAGGAGGG - Intergenic
901096414 1:6683829-6683851 CAAGGTTCTCTAGAAGAGGTGGG + Intronic
901910918 1:12457292-12457314 CAAGGAAATGAGGCAGAGGAGGG - Intronic
902082506 1:13830742-13830764 CAAGATGACCAAGAAGAGAAGGG - Intergenic
903010247 1:20324703-20324725 CAAGCTCAGCAAGGAGAGGAGGG + Intronic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
903528097 1:24008279-24008301 CAAGTTTATCAAGAAAAGGGTGG - Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
905697138 1:39983064-39983086 CACTGTAATCAAGTAGGGGAGGG - Intergenic
906090594 1:43176249-43176271 CAACGTGATCTAGAAGAGGCAGG + Intronic
908971919 1:69845939-69845961 AAAGATAATCCTGAAGAGGATGG - Intronic
909586560 1:77296045-77296067 CAAGGGAAGAAAGAAGAGGGTGG + Intronic
909595870 1:77405670-77405692 CAGTGTAACCAAGAAGTGGAGGG + Intronic
910260597 1:85290025-85290047 CAAGGTTATCATCAAGAAGATGG - Intergenic
911344179 1:96676175-96676197 CTATGCAAGCAAGAAGAGGATGG - Intergenic
911950671 1:104170381-104170403 CAAAGTAAGCAAGGAGAGAATGG + Intergenic
913559625 1:120004599-120004621 CAAGGTAATGAAGAAGCAAAAGG + Intronic
913638235 1:120785942-120785964 CAAGGTAATGAAGAAGCAAAAGG - Intergenic
914280213 1:146164020-146164042 CAAGGTAATGAAGAAGCAAAAGG + Intronic
914541258 1:148614959-148614981 CAAGGTAATGAAGAAGCAAAAGG + Intronic
914625382 1:149456286-149456308 CAAGGTAATGAAGAAGCAAAAGG - Intergenic
915016405 1:152737973-152737995 CAAGGAAGACAAGAAAAGGAGGG - Intronic
915058967 1:153163852-153163874 CAAGGTTATGAAGAATGGGATGG - Intergenic
915869435 1:159542238-159542260 CAAGGCAATCAAGCAGGAGAAGG + Intergenic
916153635 1:161822213-161822235 CAAGGAGAACAAGTAGAGGAAGG + Intronic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918245173 1:182652869-182652891 CAAGGGAAGGAAGGAGAGGAAGG + Intronic
921056282 1:211544978-211545000 CAAGGTGATCAAGAACCAGAGGG - Intergenic
921334318 1:214071125-214071147 CAAGGGAAGAAAGAAAAGGAGGG + Intergenic
921334391 1:214071842-214071864 CAAGGGAAGCAAGAAAAAGAGGG - Intergenic
921382544 1:214539687-214539709 AAAGGCAATAAAGAAGAGGGAGG + Intronic
921546412 1:216480166-216480188 TAAGGTAATCAAAAACAGCATGG + Intergenic
921780871 1:219161886-219161908 CAAGGTAAGCAAGAAAAGAGAGG + Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923014245 1:230113581-230113603 CAAAGTGCTCAAGAAGTGGACGG + Intronic
923101596 1:230821859-230821881 CCAGGAAATCCAGGAGAGGATGG + Intergenic
924140455 1:241017630-241017652 CTATGCAATCAAGAAGAGAATGG - Intronic
924289126 1:242520258-242520280 CAAGGCAACCAAGATGAGGATGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063935189 10:11070415-11070437 TAAGGGAATTAAGCAGAGGACGG + Intronic
1064383077 10:14863686-14863708 GAAGGCAAAAAAGAAGAGGAGGG - Intronic
1064680864 10:17809578-17809600 CACAGTAACCCAGAAGAGGAAGG - Intronic
1064753914 10:18557944-18557966 GAAGGTAATCAAGAATTGAATGG + Intronic
1067580758 10:47444063-47444085 CCAGGGAATAGAGAAGAGGAAGG + Intergenic
1068590351 10:58846566-58846588 CCAGGTAATCAAGAAGTCCATGG - Intergenic
1068627292 10:59263080-59263102 CAAGGAAATACAGGAGAGGATGG + Intronic
1068926191 10:62541721-62541743 CAAGATAAGGAACAAGAGGAAGG + Intronic
1071809576 10:89164779-89164801 GATGGTAAGGAAGAAGAGGAAGG + Intergenic
1071961805 10:90814487-90814509 TAAAGTAATTAAGAAGAGCATGG + Intronic
1073066749 10:100764921-100764943 GGAGGTAAACAGGAAGAGGAGGG + Intronic
1073709857 10:106023799-106023821 CAAGGAAATTAAAAAGAGAAAGG - Intergenic
1073971184 10:109046648-109046670 CAAAGCCATCAAAAAGAGGAAGG + Intergenic
1074585224 10:114761829-114761851 CCAGGTAAAAAAGAATAGGATGG - Intergenic
1074650610 10:115520280-115520302 CAAGACAATCAAAAAGATGATGG - Intronic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG + Exonic
1080297424 11:30746277-30746299 CAAGACAATCAAGAAGAGACAGG - Intergenic
1081288112 11:41297484-41297506 AAAGTTAATGAAGAAGAGGGTGG + Intronic
1081387487 11:42488865-42488887 AGAGGAAATCAAGAAGAGAAGGG + Intergenic
1084468509 11:69341484-69341506 CAAGGTAGGAAGGAAGAGGAAGG - Intronic
1086326757 11:85709236-85709258 TAAAGTAATCAAGAGGAGGGAGG - Intronic
1088047790 11:105474416-105474438 CAAGGTATTGAGGATGAGGAAGG + Intergenic
1088450476 11:109976649-109976671 TAAGGTAATCAACAAGAAGTAGG + Intergenic
1088523607 11:110727314-110727336 CAATGTAAGCAAGGAGAGAATGG - Intergenic
1088742944 11:112781539-112781561 CAAGGAAAGAAAGAAGAGGCTGG + Intergenic
1089290575 11:117435668-117435690 CATCGTACGCAAGAAGAGGAAGG - Exonic
1089537671 11:119170447-119170469 CAAGGTAAATGACAAGAGGAGGG + Intronic
1091005539 11:131950005-131950027 CAAGGTAGTCAAGATAGGGAAGG - Intronic
1092788508 12:12051447-12051469 TAAGGTATTCAAGCAGAGGCAGG - Intronic
1093058399 12:14578104-14578126 CAAGATGAACAATAAGAGGATGG - Intergenic
1093970990 12:25375923-25375945 TTAGGAAATCAGGAAGAGGATGG - Intergenic
1094470602 12:30797718-30797740 CAAGGAAATGAAGATGATGATGG - Intergenic
1096310328 12:50515076-50515098 AAAGGTAAGAAATAAGAGGAAGG - Intronic
1097105895 12:56624238-56624260 GAAGGTAGTTAAGGAGAGGATGG - Intronic
1097458014 12:59824254-59824276 CAAGGTAAGCAAGGAATGGATGG - Intergenic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098381798 12:69877813-69877835 CAAGAGAATCAAGTAGAGGTTGG + Intronic
1099378496 12:81924527-81924549 CAAGGTAGTAAGGAATAGGAAGG - Intergenic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1100157179 12:91813805-91813827 CAAAGAAATGAAGATGAGGAAGG + Intergenic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1100705448 12:97195661-97195683 CAAGGTATTGAACATGAGGAAGG + Intergenic
1101598678 12:106189621-106189643 TAGGGAAATCAAGTAGAGGAAGG + Intergenic
1102937307 12:116908524-116908546 CAAGTTCATCAAGAAGAGAGCGG + Intergenic
1102940273 12:116935144-116935166 CAAAGTAATAAAGAAAAAGAGGG + Intronic
1106855219 13:33844357-33844379 GAAGGTAATCAACAATTGGAAGG - Intronic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107519920 13:41169524-41169546 CAAAGCAATCAAGAAGAAGGAGG - Intergenic
1110001869 13:70212875-70212897 CAAGGCAATCAGGCAGGGGAAGG + Intergenic
1110460974 13:75745477-75745499 TAAAGAAATCAAGAAGATGAGGG + Intronic
1111083044 13:83337373-83337395 CAAGGTAAAGAAGAAGAAGAAGG + Intergenic
1111713221 13:91844389-91844411 CTAGGGAATCAAGACAAGGAGGG + Intronic
1111780395 13:92716358-92716380 CAAGGCAAACAAGCAGAGGAAGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1114462800 14:22898741-22898763 TAAGGAAACCAAGCAGAGGAAGG + Intergenic
1114488583 14:23080646-23080668 GAAGATGATGAAGAAGAGGAAGG - Exonic
1114952565 14:27774813-27774835 AAATGAAATCAAGAAAAGGAAGG - Intergenic
1115431653 14:33325970-33325992 TAGGGTACTCAAGAATAGGATGG + Intronic
1116596448 14:46853579-46853601 CAATGCAAACAAGAAGAGTATGG + Intronic
1117756528 14:58980010-58980032 CATGGTTAGCAAGAGGAGGAAGG - Intergenic
1117978144 14:61318585-61318607 GAAGGGAATGAGGAAGAGGACGG - Intronic
1119123538 14:72101901-72101923 GCAGGTAATAGAGAAGAGGATGG - Intronic
1119223939 14:72929698-72929720 CAAGTTCATCAAGAAAAGGGTGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1121591902 14:95121184-95121206 CAAGGTCATCAAAAACAAGACGG + Intronic
1124081514 15:26502386-26502408 AAAAATAAACAAGAAGAGGAAGG - Intergenic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1127680655 15:61294109-61294131 CAAGGTAATCTGGAAGAAAATGG + Intergenic
1127960319 15:63885669-63885691 GAATGTAGTCAGGAAGAGGAGGG - Intergenic
1130626515 15:85521147-85521169 TAAGTTAATCAACAAGATGAAGG - Intronic
1131228760 15:90645832-90645854 CAAGGGAAGCTAGGAGAGGACGG - Intergenic
1131429336 15:92374162-92374184 TAAGGTCATCCAGGAGAGGAGGG - Intergenic
1132058670 15:98672205-98672227 CAAAGTAACCAAGAAAATGATGG + Intronic
1132286000 15:100663046-100663068 CAAGCTAATCAGGAAGAAAATGG - Intergenic
1133622768 16:7542373-7542395 CCGGGTAATCCAGAAGAGGTGGG - Intronic
1134531563 16:14988370-14988392 CAAGCTGAACCAGAAGAGGAAGG + Intronic
1135513545 16:23110283-23110305 GAGGCTAATTAAGAAGAGGACGG + Intronic
1138739883 16:59295656-59295678 GAAGGTAAGAAAGAGGAGGAAGG + Intergenic
1140136166 16:72207370-72207392 CAAGAGAATCAAGAAGAAAAAGG + Intergenic
1141414185 16:83857369-83857391 CAAGATAAGGAAGAAGGGGAAGG + Intergenic
1146252608 17:31362533-31362555 CAAGGAAATAAAGAAGGAGAAGG - Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146738063 17:35256691-35256713 CAAGGCAATCACTAAAAGGAAGG - Intronic
1148006011 17:44430154-44430176 CAAGGGAAAATAGAAGAGGAAGG + Intronic
1148165117 17:45478129-45478151 CTAGGTCATCAAGAAGAAGCTGG - Exonic
1149480597 17:57000208-57000230 CAAGGTAATGAAGAAGAAAATGG + Intronic
1150129086 17:62657131-62657153 CAAGGAGAACAAGAAGGGGATGG + Intronic
1150396348 17:64824854-64824876 CTAGGTCATCAAGAAGAAGCTGG - Intergenic
1150973746 17:70060279-70060301 AAAGGCAATAAAGAAGATGAAGG + Intronic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1152277617 17:79367316-79367338 AGAGGAAATGAAGAAGAGGAGGG - Intronic
1152937314 17:83147487-83147509 CAAGGTAACCAATAAAATGAAGG - Intergenic
1156446093 18:37237895-37237917 GAAGATAATCAAGGAGAGAAGGG + Intergenic
1157522603 18:48355750-48355772 CAAAGAAATTGAGAAGAGGAAGG - Intronic
1158388469 18:57021667-57021689 TAAGGTAATTAAAAAGAAGATGG - Intronic
1159547636 18:69859663-69859685 CAAGGTAACAAAAATGAGGAAGG + Exonic
1159725128 18:71947995-71948017 AAAGGAGAACAAGAAGAGGAAGG + Intergenic
1160384523 18:78486778-78486800 CATGCTGATGAAGAAGAGGATGG - Intergenic
1160562803 18:79770383-79770405 CACGGTGAGCCAGAAGAGGATGG + Intergenic
1161860120 19:6791758-6791780 CAAGGGGAAGAAGAAGAGGAGGG + Intronic
1162522775 19:11191718-11191740 CAGGGAAAACAAGAAGAGAAAGG + Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1165395898 19:35563446-35563468 CAAGATGAGCAAGAAGAAGAAGG - Exonic
1166189983 19:41170058-41170080 CAAGTTCATCAAGAAAAGGATGG + Intergenic
1167196102 19:48029853-48029875 CCAGGAAATCAGGAAAAGGAAGG + Intergenic
1167649809 19:50723139-50723161 TCAGATAATCAGGAAGAGGATGG - Intergenic
1167955797 19:53062813-53062835 CAAGTTAATTAAGAAGAGAATGG - Intergenic
1168596182 19:57679557-57679579 CCAGATAATCAAGAAGGGAATGG + Intergenic
925043831 2:755682-755704 CAAAGAGATCAAGAGGAGGAGGG + Intergenic
926703455 2:15819580-15819602 CAAGGGTATAAAGAGGAGGAAGG - Intergenic
928782680 2:34844079-34844101 CTAGGAAGTCAAAAAGAGGAGGG + Intergenic
929018132 2:37522301-37522323 CAAGGAAATCAGGAAGTGTAGGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930645504 2:53902107-53902129 TAAGGTAATAAAGAAATGGAAGG + Intronic
931911283 2:66902826-66902848 CAAGGAAATTAAGAAGAATATGG + Intergenic
932856290 2:75237090-75237112 TAAAGAAATCAAGAAGAGGCCGG - Intergenic
933326966 2:80850172-80850194 CAAGGTAAACAAGGAGGGGCCGG - Intergenic
933878057 2:86638971-86638993 AAAGGTAATGAAGTAGAGAAAGG - Intronic
934484692 2:94694143-94694165 AAATGAAATCAAGAAAAGGAAGG + Intergenic
937349886 2:121154013-121154035 CAAGGGGATGAAGCAGAGGAAGG - Intergenic
937701986 2:124873265-124873287 CAAGGACATCAACAAGAGGATGG + Intronic
938133026 2:128733439-128733461 CAAGGTAATACAGCAAAGGAAGG - Intergenic
940238879 2:151541711-151541733 CAAGGGAAAAAAGAAAAGGAGGG - Intronic
940707393 2:157122678-157122700 CAAGGAGATCAGGACGAGGAAGG - Intergenic
940923281 2:159334424-159334446 CAAGGTTATCAAGAAAAAGAGGG - Intronic
941633255 2:167907612-167907634 GAAAGAAATGAAGAAGAGGAAGG + Intergenic
941763608 2:169271922-169271944 CCAGGGAGTCAAGAAGATGAAGG + Intronic
942305729 2:174605685-174605707 CAAAGTAATATAGAAAAGGAGGG + Intronic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
944293357 2:198033650-198033672 AAAGGTAAACAAGATGAGGTTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945058019 2:205884973-205884995 CAAGGTGACCCAGATGAGGAGGG - Intergenic
945827310 2:214738646-214738668 CAAGGAAATTAAAAAAAGGAGGG + Intronic
947587096 2:231363070-231363092 CAAGGTATTCAGGAAGTGCAGGG + Intronic
947777560 2:232726061-232726083 AAAGGTAAGCAAGATGAGGCTGG + Intronic
948337617 2:237222987-237223009 TAAGGTAATCTAGAAGGGTATGG - Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
1168958234 20:1849497-1849519 CATGGTAATCAAAAAGAGGTCGG + Intergenic
1170024283 20:11872092-11872114 GAAGAAAAACAAGAAGAGGAAGG - Intergenic
1170950422 20:20931167-20931189 CAAGGTTGTCAAGAAGTGGGTGG + Intergenic
1171951051 20:31422878-31422900 CAAGGTAACCAAACAGATGAGGG + Intergenic
1172685831 20:36753701-36753723 CAATGTGATCAATAAGAAGATGG + Intronic
1172786818 20:37474030-37474052 CAAGATTCTTAAGAAGAGGACGG - Intergenic
1172964598 20:38825521-38825543 CTAGGAACTCAAGCAGAGGAGGG - Intronic
1173022866 20:39282750-39282772 CAAGGGAAACAAGCAGAGGCAGG - Intergenic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1175428184 20:58883746-58883768 CATGGAAATCAAGCAGAGGAAGG + Intronic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
1177617276 21:23539407-23539429 CCATGCAATCTAGAAGAGGAAGG - Intergenic
1178033049 21:28549886-28549908 CAAGGTCATAAAGAAGAGCAGGG - Intergenic
1181711313 22:24693042-24693064 CAAGGTAAACATGAAAAGTAAGG + Intergenic
1182329777 22:29543039-29543061 AAAGGGAATAAAGAAGGGGATGG + Intronic
1184613000 22:45617760-45617782 CAAGTTAGTAGAGAAGAGGATGG - Intergenic
1184928417 22:47660844-47660866 TAAGGCAATAAAGAAGATGAGGG - Intergenic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
949120309 3:376018-376040 CAAGGTAATTAAGCAGATGAAGG + Intronic
951447472 3:22799196-22799218 CAAGATAACCTAGAAAAGGATGG - Intergenic
952826626 3:37530051-37530073 CAAGGGAATCAGGGAGAGCAGGG + Intronic
952897923 3:38090945-38090967 CAAAATAATCTAGAAGAGCAGGG - Intronic
955397474 3:58567282-58567304 CCAGCTCATCAAGAAGAAGAAGG - Exonic
955420547 3:58732735-58732757 CAAGAAAATAGAGAAGAGGAGGG - Intronic
956360636 3:68443091-68443113 CAAGGTAATTACGAAGTAGATGG - Intronic
956398812 3:68854278-68854300 CAAGGTGAACAAGAAGAGAATGG + Intronic
956752082 3:72351477-72351499 CAAGTTAAGCAAAAAGAGAAAGG + Intergenic
956941403 3:74166106-74166128 CAAGTGAATCAATAAGAGAATGG - Intergenic
957629096 3:82695335-82695357 GAGTTTAATCAAGAAGAGGAAGG + Intergenic
958736691 3:98017478-98017500 CAAGGTTAGAATGAAGAGGATGG + Intronic
959127065 3:102302593-102302615 AAAGGTAATAAAGAAGCAGATGG + Intronic
960377486 3:116921444-116921466 CAAGGTTACCAAGAAGCAGATGG + Intronic
961086375 3:124071082-124071104 GAAGGTGATCAGGAAGGGGAGGG + Intergenic
961259603 3:125590617-125590639 CAAAATAATCAGGAAAAGGAAGG - Intronic
961983601 3:131107487-131107509 GAAGGTATTCAGGAAGAAGATGG + Intronic
963224030 3:142842796-142842818 TAAGGGATACAAGAAGAGGAAGG - Intronic
963776850 3:149448500-149448522 GAAGGGAAGGAAGAAGAGGAAGG - Intergenic
964373475 3:156026347-156026369 CAAGGAGATTAATAAGAGGAAGG + Intergenic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
968296418 3:197580427-197580449 CAAGTTCATCAAGAAAAGGGTGG - Intergenic
970267340 4:14302919-14302941 CAAGAAAATCAAGAATGGGATGG - Intergenic
971219502 4:24691945-24691967 GAAGATAATGCAGAAGAGGAGGG - Intergenic
972215170 4:36889922-36889944 CAAGGTAAAAGAGAAGAGGCAGG - Intergenic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
974876783 4:67712094-67712116 CATGGCAAACAAGAAGAGGGAGG + Intergenic
975412165 4:74066253-74066275 CAAGTTTATTAAGAAAAGGAAGG + Intergenic
976213730 4:82695788-82695810 CTAGGCAAAGAAGAAGAGGAGGG - Intronic
976236849 4:82906524-82906546 CAGGATGATCAAGAAGAGAAAGG + Exonic
977192899 4:94022567-94022589 CAAGGAGATTGAGAAGAGGAAGG + Intergenic
977913355 4:102562864-102562886 AATGGTAATGAAGAAGAGGAGGG - Intronic
979811702 4:125044209-125044231 CAAGGTATTCAAGAAGAGCATGG + Intergenic
981115238 4:140982376-140982398 GAAGGTTTTCAAGAGGAGGAAGG - Intronic
981983819 4:150829573-150829595 CAAGGAAAACAAAAAGAGAATGG - Intronic
982565092 4:156975998-156976020 AATGGTAATCAAAAAGAAGAGGG + Intergenic
983214632 4:164991774-164991796 CAAGGGAACCAAAAAGAGGTTGG - Intergenic
984348292 4:178559712-178559734 CTAGCTAATCAAGATGAGGTTGG + Intergenic
984593315 4:181640107-181640129 CAGGGACATCAAGAAGATGAAGG + Intergenic
985764969 5:1772559-1772581 AAAGGAAATGAAGAAGGGGAAGG + Intergenic
986242013 5:5969350-5969372 CAAGTTAATCAACAAGAAGCTGG - Intergenic
986868640 5:12019949-12019971 CATGGAAATCTAGAAGAGAATGG - Intergenic
987379827 5:17275225-17275247 CAAGCTCAGCAAGAAGAAGAAGG + Exonic
988434000 5:31152083-31152105 CAAGGTAGGCAAGAAGAGTGGGG - Intergenic
988966331 5:36421890-36421912 CAAGGTACCCTAGTAGAGGAAGG - Intergenic
988976771 5:36523858-36523880 CAAGGGAAACATGAAGATGAAGG - Intergenic
989340900 5:40374558-40374580 CAAGGTTATCAAGCTGAGGAAGG + Intergenic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
990888273 5:60619286-60619308 CAAGGCAATCAGGAAGGAGAAGG + Intronic
991153198 5:63396942-63396964 CAAGGGAAAGAAGTAGAGGATGG + Intergenic
994658746 5:102627444-102627466 CAAGGAAAGCAAGAATAGGCTGG + Intergenic
994744473 5:103661947-103661969 CAAGGTAATCAAGAAAAAGTTGG - Intergenic
995133522 5:108656200-108656222 CAAGGTAATCTGGCAGAAGAGGG - Intergenic
995769442 5:115653087-115653109 CATATTAATTAAGAAGAGGACGG - Intergenic
996106350 5:119508750-119508772 CAAAGCAGTCAAGAAGAGCATGG - Intronic
996282062 5:121741981-121742003 CAAGTTATCCAAGAAGAGCAAGG + Intergenic
996536469 5:124583016-124583038 AAAGGCAATTAAGAACAGGAAGG - Intergenic
996998524 5:129728470-129728492 CAAGGTAATTAAGAAGATAAAGG - Intronic
997389773 5:133504610-133504632 CAAGGTAATGCAGTAGAGGTAGG - Intronic
997771130 5:136555667-136555689 CAGGGAAAACAAGAATAGGAGGG - Intergenic
998258513 5:140609295-140609317 CAAGTTCATCAAGAAAAGGGTGG + Intergenic
999015180 5:148095084-148095106 AAATGTAATCTACAAGAGGAGGG - Intronic
999805416 5:155076682-155076704 CCAGGTACACAAGAAAAGGAGGG - Intergenic
1000153859 5:158531185-158531207 CAAGGTAATAGAGCAGAGAATGG - Intergenic
1001460766 5:171911592-171911614 GAAGGTAATCAAAAGAAGGATGG - Intronic
1001982978 5:176048796-176048818 CAAGTGAAGCAAGCAGAGGAAGG + Intergenic
1002234485 5:177795260-177795282 CAAGTGAAGCAAGCAGAGGAAGG - Intergenic
1002254782 5:177951026-177951048 AAAGGTAAACAATAAGGGGATGG - Intergenic
1002989397 6:2223991-2224013 CAAGGAAAACCAGCAGAGGAGGG + Intronic
1003659720 6:8049024-8049046 AAAGGAAAGAAAGAAGAGGAGGG + Intronic
1003748492 6:9029352-9029374 CCATGTAAGCAAGAAAAGGAAGG - Intergenic
1004292699 6:14382944-14382966 AAAGGAAAGGAAGAAGAGGAAGG - Intergenic
1004627326 6:17389258-17389280 GAAGGTATTTGAGAAGAGGAAGG - Intergenic
1005560951 6:27040230-27040252 AAATGTATTCAAGGAGAGGAAGG + Intergenic
1005598074 6:27398276-27398298 CAAGTGAATTAACAAGAGGAGGG + Intronic
1005768919 6:29045059-29045081 CAATGTAATTAAGTAGAAGATGG + Exonic
1005980473 6:30832511-30832533 AAAGGTGATCAAAAAGAAGATGG - Intergenic
1006524888 6:34595869-34595891 CCAGGAAATGAGGAAGAGGAGGG - Intronic
1006921341 6:37629515-37629537 CAAGGAGAGGAAGAAGAGGAGGG + Intergenic
1007299753 6:40857932-40857954 CAAGGATAGCATGAAGAGGACGG - Intergenic
1009338446 6:62524015-62524037 CAAGGCTATGAAGAAGAGAAAGG - Intergenic
1009371226 6:62905649-62905671 AAAGGGAAGGAAGAAGAGGAAGG + Intergenic
1011261264 6:85472162-85472184 CAAGGAAAGGAAGAAGAGGCTGG + Intronic
1012634637 6:101522605-101522627 CCAAGTATTCAAGAAGAAGAAGG + Intronic
1012757899 6:103255647-103255669 TAATGTAATCATGAAGAAGATGG - Intergenic
1013237340 6:108208845-108208867 CAAGGTTAACCAGGAGAGGATGG - Intergenic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1014036300 6:116770137-116770159 CAAGGTAATGAAATAGAGGGTGG - Intergenic
1014229042 6:118881876-118881898 CCAGCTAAGCAAGAAGAGAAGGG - Intronic
1014634105 6:123823756-123823778 CAAGAGACTCAAGAAGAGGAAGG + Intronic
1014697007 6:124635021-124635043 TAAGGAAAGGAAGAAGAGGAAGG + Intronic
1015027731 6:128557324-128557346 CAAAGTATGCAAGAAGAGAATGG + Intergenic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017864983 6:158435383-158435405 CAAGGTAGCCGAGCAGAGGATGG - Intronic
1018423709 6:163662078-163662100 CCAGGTAAACAAGAGAAGGAAGG + Intergenic
1022020503 7:26395967-26395989 CAAGGTCAGCAAGCTGAGGATGG + Intergenic
1022384657 7:29889990-29890012 CAATGAAATCAGGAGGAGGAGGG - Intronic
1023296598 7:38721374-38721396 CAAGGCAACCTAGAAGAGAAGGG + Intergenic
1025298621 7:57798054-57798076 AAAGATAACCAAGGAGAGGATGG - Intergenic
1026814439 7:73499399-73499421 AAAGGTAATTAAGTAGAGAAAGG - Intronic
1028438802 7:90835088-90835110 CAAAGTAAACAAGAAGATAAAGG + Intronic
1028829361 7:95310607-95310629 CCAGATAAGAAAGAAGAGGAAGG + Intronic
1029796115 7:102896220-102896242 CCAGGTACTTAAGCAGAGGAAGG + Intronic
1030647987 7:112085565-112085587 CAAGGTAATCAAGTAGCAGATGG + Intronic
1031018967 7:116606016-116606038 GAAGGGAATGAAGGAGAGGAAGG + Intergenic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031360872 7:120846892-120846914 CAAGTTACTCAGGAAAAGGAGGG + Intronic
1032333879 7:131006355-131006377 AAAGATAATCATGAAGAAGATGG + Intergenic
1032553309 7:132805821-132805843 CATGGAAGTAAAGAAGAGGAAGG + Intronic
1033178268 7:139147833-139147855 GAAGGTAATGCAAAAGAGGATGG - Intronic
1033344696 7:140518030-140518052 CAAGGCAGTCAAGAAGAGTCAGG + Intergenic
1035781237 8:2229650-2229672 CAAGGAAGGGAAGAAGAGGAAGG - Intergenic
1036485759 8:9177433-9177455 AAAGGAAAACAAGAAAAGGAAGG - Intergenic
1040667467 8:49651637-49651659 CAAAGTCATCAAAAAGGGGAAGG - Intergenic
1042025150 8:64415253-64415275 CAAGGTAATCAGGAAGGTGGGGG - Intergenic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1042574926 8:70207239-70207261 CAAGGTGATCAAGAAAACAAGGG + Intronic
1047296239 8:123572805-123572827 GAAGGTAATGAAGAGGAGGGAGG - Intergenic
1047394391 8:124481587-124481609 CAAGGTAGCCAAAAAGAGGCAGG - Intronic
1047516594 8:125560282-125560304 GAAGTTAATCACGAACAGGAAGG - Intergenic
1047744676 8:127835760-127835782 AGAGGTAGTCAAGAAGAGGTTGG + Intergenic
1048608735 8:135998638-135998660 CTATGCAAGCAAGAAGAGGATGG + Intergenic
1048628022 8:136208012-136208034 CAAGGTAAGAAAGATGAGCAGGG - Intergenic
1048888373 8:138926672-138926694 GAAGGGAATCAATAAAAGGAAGG - Intergenic
1049365275 8:142234037-142234059 CATGGTAACCAAGAAGAGAGAGG + Intronic
1049877356 8:145033421-145033443 CAAAGCCATCAAAAAGAGGAAGG + Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1050586405 9:7116429-7116451 TTAGGTGATCAAGAACAGGAGGG + Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1054384207 9:64530298-64530320 AAATGAAATCAAGAAAAGGAAGG - Intergenic
1054868876 9:70030870-70030892 GAAGGAAATAAAGAAAAGGAAGG - Intergenic
1055500735 9:76900150-76900172 CAAGGAAGTACAGAAGAGGACGG + Intronic
1055668039 9:78571564-78571586 CAAGGTAATGAGTTAGAGGAGGG - Intergenic
1055937892 9:81620467-81620489 CAATGACATCAAGAAAAGGAAGG - Exonic
1056330025 9:85513336-85513358 CAAGGTAATAAAGAATAAGAAGG + Intergenic
1056655576 9:88505989-88506011 CTAGGTCAGCAAGAGGAGGAGGG - Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1058205130 9:102096152-102096174 CAAGGTAATCTAGAAAAAAATGG - Intergenic
1058331626 9:103768725-103768747 CTAGGTAGTAAAGAAGATGATGG - Intergenic
1058475888 9:105332616-105332638 CAAAGAAAACAAGAACAGGAGGG - Intronic
1059933744 9:119286758-119286780 CAAGGTCATGCACAAGAGGACGG + Intronic
1059984340 9:119807517-119807539 CAAGGTAATCCAGCAGAGTAAGG + Intergenic
1060484704 9:124039746-124039768 GAAAGTCATCAGGAAGAGGAAGG + Intergenic
1189050926 X:37644703-37644725 TATGATAATGAAGAAGAGGAGGG - Intronic
1189438681 X:41015284-41015306 CAAGACAATCAAGAAGAGGTGGG + Intergenic
1189785199 X:44553123-44553145 CCAGGTATTCAAGTAGAGAAAGG - Intergenic
1190064456 X:47230373-47230395 CTAGGAAACCATGAAGAGGAGGG + Intergenic
1190339471 X:49285774-49285796 CAAGGGAATGAAGCAGAGGAGGG - Intronic
1190490208 X:50974519-50974541 GAACTTAATCAAGAAGAGCAAGG - Intergenic
1190975922 X:55400670-55400692 CAAGGCAATCAGGCAGAAGAAGG + Intergenic
1191937686 X:66442799-66442821 GAAGGGAACAAAGAAGAGGAGGG - Intergenic
1192030284 X:67503946-67503968 CAAGGTAACCACAAAGAGAAAGG + Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193767518 X:85548694-85548716 CAAGTTAGTCAAGAGGAAGATGG - Intergenic
1194024446 X:88734835-88734857 CAAGGCAATCCAGAACATGAAGG - Intergenic
1194670197 X:96722442-96722464 CAAGGAAATACAGTAGAGGAAGG - Intronic
1195516732 X:105785268-105785290 GAAGTTATTCAAGAAAAGGAAGG + Intergenic
1195624910 X:106997872-106997894 CCAGTTTATCAGGAAGAGGAAGG - Intronic
1196154798 X:112416985-112417007 CAATGTAATCCAAAGGAGGAGGG + Intergenic
1196206853 X:112949644-112949666 GAAAGTAAGGAAGAAGAGGAAGG - Intergenic
1196246721 X:113408541-113408563 CCAAGAAATAAAGAAGAGGAAGG - Intergenic
1196390162 X:115198641-115198663 CAAGTTCATCAAGAAAAGGGTGG + Intronic
1197590078 X:128397773-128397795 GAAAGAAGTCAAGAAGAGGATGG + Intergenic
1197832902 X:130663829-130663851 GAAAGTGATCAAGAGGAGGAGGG - Intronic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198537365 X:137599915-137599937 CAAGGAGATCACCAAGAGGACGG + Intergenic
1198839600 X:140842068-140842090 CAGGGTAATAAAGGATAGGATGG + Intergenic
1199227921 X:145400426-145400448 AATGGTAATCAAAAAGAGTAAGG + Intergenic
1201620662 Y:15953554-15953576 CAAGGTAGTCAAATAGAGGATGG + Intergenic