ID: 1099724184

View in Genome Browser
Species Human (GRCh38)
Location 12:86403679-86403701
Sequence TTTTAGGTATAGATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099724184 Original CRISPR TTTTAGGTATAGATTTTGGA AGG Intronic
902318022 1:15638466-15638488 TGTCAGGTAAAGATGTTGGAGGG - Intronic
902596562 1:17513704-17513726 TTGGAGGTATTAATTTTGGAGGG + Intergenic
903560979 1:24227203-24227225 TTTAAGGAATATATTTTGTAAGG - Intergenic
905661618 1:39730802-39730824 TTTCAGGTATATATTTAGGTTGG + Intronic
906083727 1:43111780-43111802 TATTGGGTATATATTTAGGACGG + Intergenic
907981092 1:59481728-59481750 TTTTAGGTATTGTATTTGCAAGG + Intronic
908542426 1:65134259-65134281 TTTTTGGAATACAATTTGGAAGG + Intergenic
909191508 1:72558328-72558350 TTTTATGAATAAATTTTGAAGGG - Intergenic
909347205 1:74604513-74604535 TTTAAGGAATATATTTTGTAAGG - Intronic
910047396 1:82933980-82934002 TTTCAGGAATAGATTTTAGGTGG - Intergenic
910915403 1:92282907-92282929 TTTTAGGTTTAGTCTTGGGAGGG - Intronic
910985809 1:93003538-93003560 TTTTAGATATTTATTTTGTAGGG - Intergenic
911159555 1:94671039-94671061 TTGTAGGTAAAGATTTTTAAAGG + Intergenic
911240158 1:95456569-95456591 TTCCTGGTTTAGATTTTGGAGGG - Intergenic
912033465 1:105280405-105280427 TATTAAGAATAGATTGTGGATGG + Intergenic
912758420 1:112344598-112344620 GTTTTTGTATACATTTTGGAAGG + Intergenic
915862516 1:159461210-159461232 ATTTTGGTATAGATTTTTGGTGG + Intergenic
916399337 1:164429046-164429068 TTGTATGTCTAGATTTGGGATGG - Intergenic
916691524 1:167194579-167194601 TTTGAGGTAAACATTTTTGAGGG - Intergenic
918281618 1:183011541-183011563 TTTGATGTATGAATTTTGGAGGG + Intergenic
918499243 1:185175633-185175655 TTTTAGGAAGATATTTTGGCAGG + Intronic
918573032 1:186021328-186021350 TTTGAGTTTTAGATTTTGGGGGG + Intronic
918671086 1:187217357-187217379 TGTTAAATATAGATTTTAGATGG - Intergenic
919383537 1:196889710-196889732 TTTTACAAATAAATTTTGGAGGG - Intronic
920572688 1:207029606-207029628 TATTAGGTTGAGCTTTTGGAAGG + Intronic
920877250 1:209848554-209848576 TTCTTGGGATAGATTTTGAAAGG + Intronic
921909473 1:220530945-220530967 TTTTAGGTAAAGGGTTGGGAAGG + Intronic
922878091 1:228956925-228956947 TTTTAGGAATAGTTTAAGGAGGG - Intergenic
923132419 1:231088106-231088128 TTTTAATTATATATTTTAGAAGG + Intergenic
923379174 1:233397683-233397705 TTTTATTTATTTATTTTGGAGGG - Intergenic
923613251 1:235514021-235514043 ATTTAATTAGAGATTTTGGATGG + Intergenic
1063632952 10:7751175-7751197 TTTTAGGAATTGATTTTTTAAGG - Exonic
1064642905 10:17432333-17432355 TTTTGAGAATAGATTCTGGAAGG + Intronic
1065269172 10:24009206-24009228 TTTTGGGTATAGAATGTGGTAGG + Intronic
1065358200 10:24863569-24863591 TTTAAGAAATAGATTTTGTAAGG + Intronic
1066266981 10:33785764-33785786 TTTAAGGGATATATTTTGTAAGG + Intergenic
1067520448 10:46997700-46997722 TTTTAACTATTGATTTTTGAGGG - Intronic
1068039999 10:51811827-51811849 TTTTAGTGATAGATTTGGAATGG + Intronic
1068273113 10:54755548-54755570 TTTTAGGAAGAGAATTTGAATGG + Intronic
1068282219 10:54888542-54888564 TTTTAGGTAAATACTTAGGATGG + Intronic
1071911540 10:90240175-90240197 TTTTACGTTTAGCTTTTTGAGGG - Intergenic
1072053637 10:91731424-91731446 TGTTAGGTAAAGACTTTGCAAGG - Intergenic
1072112011 10:92331431-92331453 TTTTAGGTAAAGATTATGGGGGG - Intronic
1072811305 10:98464257-98464279 TTTAAGGAATAGATTTTGAAAGG + Intronic
1073766997 10:106693702-106693724 TTTTAGGTTTACTTTCTGGATGG + Intronic
1075565313 10:123499256-123499278 TTTTAGGAATAGATGGGGGAGGG + Intergenic
1076284978 10:129286193-129286215 TTTTTGGTATAGTTTTTAGTAGG - Intergenic
1078823048 11:14901737-14901759 TTGTAGGTTTATATTTTGTAGGG + Intergenic
1078967068 11:16358100-16358122 TTTTATGTATACATTCTGCATGG - Intronic
1079929740 11:26543137-26543159 TTTATGGTATAGATTTTGACAGG - Intronic
1080563784 11:33489459-33489481 TTCAATGTATGGATTTTGGAAGG + Intergenic
1081652930 11:44837073-44837095 TTTAAGAAATAGATTTTGTAAGG + Intronic
1082312389 11:50667952-50667974 TTTTTGGTAGAGTTTTTGAAGGG - Intergenic
1085382441 11:76132339-76132361 TTGTAGCTGTAGATTTTGGCCGG + Intronic
1085453321 11:76651119-76651141 TGTTTGGAATTGATTTTGGAAGG - Intergenic
1086525444 11:87719904-87719926 TTTTAGGTATAGACTGGGAATGG + Intergenic
1086598230 11:88600489-88600511 TTCTAGGTTTAAATTTTGGCTGG - Intronic
1089661275 11:119987294-119987316 GTTTAGGTATACATTTTGAGTGG + Intergenic
1089985552 11:122809589-122809611 TTTTATTTATCGATTTTTGAAGG + Intronic
1090380697 11:126325772-126325794 TTCCAGGGATAGATTTTTGAGGG + Intronic
1090923284 11:131227436-131227458 TTTATGGTATATATTTTGAATGG + Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091069630 11:132550914-132550936 TTTTTGATTTAGACTTTGGATGG + Intronic
1091077630 11:132635125-132635147 TTTTGGGTATAGATTTATGATGG + Intronic
1091243903 11:134075310-134075332 ACTTAAGTATAGATTTGGGAGGG + Intronic
1094126458 12:27027883-27027905 TTTAATGTATGAATTTTGGAGGG + Intronic
1094231127 12:28104551-28104573 CTTTAGCAATAGATTTTTGAAGG - Intergenic
1095769356 12:45935424-45935446 TTTTAGATACAGATTTTCAAAGG - Intronic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1096632960 12:52941002-52941024 TTTTAGGTATACAGTTTGATGGG - Intronic
1097655900 12:62363185-62363207 TTTTAAGAACAGATTGTGGAGGG - Intronic
1098012560 12:66070656-66070678 AATTAGGAATATATTTTGGAGGG + Intergenic
1098123005 12:67262885-67262907 TTTTTGGTGTATATTTTGTAGGG - Intergenic
1098410380 12:70176016-70176038 TTTTTGGTATAAATTTTTAAGGG - Intergenic
1098474570 12:70885389-70885411 TTTTATGTTTACATTATGGATGG - Intronic
1098730737 12:74034761-74034783 TTTTAGTTATACTTTGTGGAAGG - Intergenic
1099724184 12:86403679-86403701 TTTTAGGTATAGATTTTGGAAGG + Intronic
1100787019 12:98089497-98089519 TTTTTGGTAGAGATTAGGGAGGG - Intergenic
1105464268 13:20622945-20622967 TTTTAGTTTTAGATTTTACAGGG + Intronic
1105656261 13:22442640-22442662 ATTTGGCTATAGATTTTGGGAGG + Intergenic
1106151286 13:27105284-27105306 TTTTAGGTTTTGATTTTTCACGG + Intronic
1106596674 13:31147477-31147499 TTTTTGGTACATATTTTGGGGGG - Intronic
1107501607 13:40983961-40983983 TTTGAGGCATAGATGTTGGGAGG - Intronic
1107950904 13:45461071-45461093 TTTGAGGTTGAAATTTTGGAAGG + Intergenic
1108535643 13:51374123-51374145 TTTTTGTTATAGATTATAGAAGG - Intronic
1108593710 13:51933034-51933056 TTTTACATATAGTTTTTGCAGGG - Exonic
1108616972 13:52142631-52142653 TTTTAAGTGTTGTTTTTGGAAGG - Intronic
1108972403 13:56393442-56393464 ATTTAGATATAAATTGTGGAAGG + Intergenic
1111026421 13:82533089-82533111 TTTTTGGTGTAAATTTTGCATGG - Intergenic
1111382541 13:87478026-87478048 TTTAATGTATAATTTTTGGAGGG - Intergenic
1112089338 13:96066123-96066145 TTTTGGGTATAGAATTTTCAGGG + Intergenic
1112227542 13:97554751-97554773 TTGTTGGTATAGATTTAGAAGGG + Intergenic
1112506105 13:99976631-99976653 ATTGAAGTATAGATATTGGAAGG - Intergenic
1112904312 13:104398356-104398378 TTTTTGGTATATATTCTGCAAGG + Intergenic
1113149280 13:107243495-107243517 TTTTAGAGATAGGGTTTGGATGG - Intronic
1113555057 13:111226767-111226789 TTTAAGGAATACATTTTGTAAGG + Intronic
1114420097 14:22574999-22575021 TTTTAGGAAGAGAAATTGGATGG - Intronic
1115728582 14:36243570-36243592 ATTGAGGAATAGACTTTGGAGGG + Intergenic
1115802707 14:37013581-37013603 TATTAGGTGTAGTTTTTGGAGGG - Intronic
1116052140 14:39817388-39817410 TTTTTGTTATTGAGTTTGGAAGG + Intergenic
1117459816 14:55934185-55934207 TTACAAGTAGAGATTTTGGATGG - Intergenic
1119017726 14:71076715-71076737 CTTAAGGACTAGATTTTGGAGGG - Intronic
1119514639 14:75238577-75238599 TTTAAGGTATAAATTTTGATAGG + Intergenic
1121401389 14:93680935-93680957 TTTTACTTATAGGTTTTGGCTGG + Intronic
1121768479 14:96508439-96508461 TTTTTGGTAGAGAAGTTGGAAGG + Intronic
1123872737 15:24593215-24593237 TTTTATGTAGAGAGTTTGGTGGG + Intergenic
1125595332 15:40881737-40881759 TTTTAGGTAAAGGTTTTAGGTGG - Intergenic
1125807212 15:42503857-42503879 TTTGAGTTATAGACTTTGTATGG + Intronic
1126429247 15:48563261-48563283 TTTTAGGTAAATATTTTTAATGG + Intronic
1129028325 15:72599987-72600009 TTTGTGGTATAGGTTTTGGGAGG + Exonic
1131091277 15:89626500-89626522 TTTTGGGAATAGGATTTGGAAGG - Intronic
1133476051 16:6123097-6123119 TTTTAGGTGTAGCCTTTTGAGGG - Intronic
1133537590 16:6716866-6716888 TTCCATGTATGGATTTTGGAAGG - Intronic
1133831679 16:9329258-9329280 TTTTCTGTAAACATTTTGGAAGG - Intergenic
1133994162 16:10735090-10735112 TATTATGTATATATTCTGGATGG - Intergenic
1134278129 16:12794864-12794886 TTGCAGATAAAGATTTTGGAAGG - Intronic
1135615010 16:23903597-23903619 TTTTAACTATGGGTTTTGGATGG + Intronic
1139110425 16:63884119-63884141 ATTTATGTATACATTGTGGATGG - Intergenic
1139173403 16:64658683-64658705 TTTGAGGTTTAGGTTTAGGAGGG + Intergenic
1140749419 16:78009721-78009743 TATCTGGTATATATTTTGGAGGG + Intergenic
1150386183 17:64763101-64763123 TTTTAGGAATATATTTTGGGGGG - Intergenic
1150517574 17:65830184-65830206 TTTTAGTTATATTTTTTGGCAGG - Intronic
1151081894 17:71339125-71339147 TTTTCGGTAAAGATGTTGGGGGG + Intergenic
1151872668 17:76847084-76847106 TTTTAGTTAAAAATTTTGGCTGG - Intergenic
1154099032 18:11451573-11451595 TGTTGGATATAGATTTTTGAGGG + Intergenic
1156588019 18:38453977-38453999 CTTCAGGTATAGATTCTGGAGGG - Intergenic
1157389992 18:47293559-47293581 GTTCAGGAATAGATTTTGAATGG + Intergenic
1157598786 18:48879897-48879919 TTTTTGGTTTTGATTTTGGTTGG + Intergenic
1157800394 18:50615705-50615727 TTTTAAATATAAATTTGGGAGGG + Intronic
1158052253 18:53236745-53236767 TTTTGTGTATAGATTAAGGAAGG + Intronic
1159646502 18:70924384-70924406 TTTCTGGTATAGTCTTTGGAAGG - Intergenic
1160433290 18:78827095-78827117 ATGTAGATATAGATTGTGGAGGG - Intergenic
924985760 2:268056-268078 TTTTAGGTCCAGATCTTGGGAGG + Intronic
925997547 2:9305171-9305193 AGTGAGGTATAGATATTGGAGGG + Intronic
925997623 2:9305573-9305595 AGTGAGGTATAGATATTGGAGGG + Intronic
925997661 2:9305774-9305796 AGTGAGGTATAGATATTGGAGGG + Intronic
927367737 2:22318613-22318635 TTTTAGGTATACTTCTGGGATGG + Intergenic
928194340 2:29204017-29204039 TTTTAGGTTTATTTTCTGGAAGG + Intronic
928361701 2:30667891-30667913 TTTTAGGTATGCCTTTTGCATGG + Intergenic
928744318 2:34393891-34393913 CTTGAGGTATAGATGCTGGATGG + Intergenic
929332494 2:40700562-40700584 TTTTGAGAATAGATTTTGGGAGG + Intergenic
930912830 2:56650638-56650660 TTCAATGTATACATTTTGGAAGG - Intergenic
932064377 2:68537766-68537788 TTTTAAGTTTACATTTTGCATGG + Intronic
936579883 2:113689550-113689572 TTTAACGTATACATTTGGGAAGG + Intergenic
937528030 2:122795210-122795232 TTGGAGGTATGGATTTTTGATGG - Intergenic
939771408 2:146324358-146324380 TTTTAGGTATCCATTTGGGCAGG - Intergenic
940250491 2:151670270-151670292 TTTTAGCCCCAGATTTTGGAAGG - Intronic
941012152 2:160312605-160312627 TTTTAGGTATTGATTATTAATGG - Intronic
941481165 2:166015142-166015164 GTTTAGGTATAGAGTTTCTAGGG + Intronic
941732785 2:168936607-168936629 CTTTAGGTATAGATGTGTGATGG - Intronic
943075955 2:183195353-183195375 TTTTGGGTTTAGAGTTTAGATGG + Intergenic
943181036 2:184541496-184541518 TTTTAGGTGTATTCTTTGGATGG + Intergenic
943441448 2:187932467-187932489 TTTCAGGTGTACATATTGGAGGG - Intergenic
944020026 2:195091275-195091297 TTTTATGTGTTCATTTTGGAAGG - Intergenic
944025436 2:195160468-195160490 TATTAGGCATACACTTTGGAAGG + Intergenic
944161546 2:196666011-196666033 TTATAGACATTGATTTTGGAAGG + Intronic
944377926 2:199069739-199069761 TTCTAGGTTGAGATTTTGGAAGG - Intergenic
945316144 2:208372767-208372789 TTTTGGGTATAAATTGGGGATGG - Intronic
945327377 2:208498192-208498214 ATCTAGTTATACATTTTGGATGG - Intronic
945894779 2:215469533-215469555 TCTTAGGTATAGATTTTTTCTGG + Intergenic
947045200 2:225974432-225974454 TTTTAGAAATATATTTTGCAGGG - Intergenic
947337206 2:229099900-229099922 TTTGACGTATGAATTTTGGAGGG - Intronic
1169446950 20:5680039-5680061 TTTAATGTATAAATTTTGGGGGG + Intergenic
1169845230 20:9983098-9983120 TTTAAAGAATAGATTTTGAAAGG - Intergenic
1170269717 20:14511949-14511971 TTTGAGGTATAAAATCTGGAGGG + Intronic
1170909202 20:20547160-20547182 TTTTAGTGATAGATATTTGAAGG - Intronic
1174692460 20:52520791-52520813 TTTAAGAAATATATTTTGGAAGG - Intergenic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1174909300 20:54589378-54589400 TTTTAATTACAGATTTTAGATGG - Intronic
1174958561 20:55129487-55129509 TTCTAAGTATAGCTTTTGAAGGG + Intergenic
1176963411 21:15185585-15185607 TTTGACATATAAATTTTGGAAGG - Intergenic
1177192152 21:17864068-17864090 TTTCAGATATAGATTTTAAATGG + Intergenic
1177394870 21:20520593-20520615 TTTAACGTATGAATTTTGGAGGG + Intergenic
1177626975 21:23674618-23674640 TTTTGGGAATAAACTTTGGATGG - Intergenic
1177775717 21:25563568-25563590 TTTTAGGTACGGATGTGGGATGG + Intergenic
1177897162 21:26867056-26867078 TTTAACATATAAATTTTGGAAGG + Intergenic
1178066807 21:28913541-28913563 TTCTGGGTATGAATTTTGGAGGG - Intergenic
1178228495 21:30753148-30753170 TTTCAGTGATAGAGTTTGGATGG + Intergenic
1183044950 22:35212035-35212057 CTTAAGGAAGAGATTTTGGAGGG - Intergenic
949302334 3:2598798-2598820 TTTCATGTATATATGTTGGAGGG - Intronic
950996796 3:17508124-17508146 TTTTTGGTGTTGATTTTGCAGGG - Intronic
951657564 3:25026650-25026672 TTTAACATATAAATTTTGGATGG + Intergenic
952716174 3:36483164-36483186 TTTCAGGGAAGGATTTTGGAGGG - Intronic
952894528 3:38069013-38069035 TTTTAGGTATTAATTATAGATGG - Intronic
953174614 3:40538687-40538709 TTTAAGGAATACATTTTGTAAGG + Intronic
955981384 3:64530943-64530965 CATAATGTATAGATTTTGGAGGG + Intronic
956065619 3:65394371-65394393 TTTGAGGTATAAAGTTTAGATGG - Intronic
957001254 3:74887696-74887718 TGTTAGGTATAGGTTTTTCATGG + Intergenic
957518535 3:81288669-81288691 TTTAAGGAATACATTTTGTAAGG - Intergenic
957676301 3:83370694-83370716 TTATATGTATATATTTTGGGGGG - Intergenic
957740205 3:84256275-84256297 TTTTATTTAAAGATTTTTGATGG - Intergenic
958647685 3:96893434-96893456 TATTAGGTATGGATTTTATATGG - Intronic
958997333 3:100919822-100919844 TTCCAGGTATATATTTTTGAGGG + Intronic
959005893 3:101019588-101019610 TTTTAGGTTTATGTTTAGGATGG - Intergenic
959328989 3:104977827-104977849 TTTTAGCTATTGATATTGGTAGG - Intergenic
960140246 3:114144870-114144892 TTTTAAGTATAGAATTGAGAAGG - Intronic
960190776 3:114702602-114702624 TTTTAGGATTAGATTTCTGAGGG - Intronic
962033608 3:131627528-131627550 TTTAAGGAATACATTTTGTAAGG + Intronic
962432844 3:135336016-135336038 TTTTGGCTTTAGATTTGGGATGG + Intergenic
963293098 3:143513665-143513687 TTTAAGGAATACATTTTGCAAGG - Intronic
963371305 3:144404189-144404211 TTTTAGTTCAAGAATTTGGAAGG + Intergenic
964577590 3:158191517-158191539 TTTTATGTAGAGATGTTGCAGGG + Intronic
964830494 3:160878769-160878791 TATCAGGTATAGATTATGGAAGG + Intronic
964951974 3:162306908-162306930 TTCTAGGTATAGCTTTTGTTTGG + Intergenic
965239111 3:166171587-166171609 TTTTAGGAACCGATTATGGAGGG + Intergenic
965372360 3:167879455-167879477 TTTAATATATAAATTTTGGAAGG - Intergenic
965530175 3:169763873-169763895 TTGAAGGTATGGATTTGGGACGG + Intergenic
965877262 3:173341076-173341098 GTATAGCTATAGATTTTGCAGGG + Intergenic
967457077 3:189700832-189700854 TTTTAGGAATATGTTTGGGATGG + Intronic
969144370 4:5108356-5108378 TTTTGGATATTCATTTTGGAGGG + Intronic
970554995 4:17222301-17222323 TTTTGGGGATGTATTTTGGAAGG + Intergenic
971803979 4:31330344-31330366 TTTGACATATAAATTTTGGAGGG + Intergenic
971868702 4:32207539-32207561 TTTAAGGAATACATTTTGTAAGG + Intergenic
972918262 4:43905930-43905952 TTTCAGGTGTACATTATGGAGGG + Intergenic
973599593 4:52528884-52528906 TTTAATGTATAAATTTTGGTGGG - Intergenic
973860190 4:55056277-55056299 ATTTATGTATTTATTTTGGAAGG - Intergenic
973962620 4:56126971-56126993 TTTAACCTATAAATTTTGGAAGG - Intergenic
974260746 4:59519780-59519802 TATTAGATATAGATTTTAAAAGG + Intergenic
975092182 4:70417050-70417072 TTTTAGGCAGAGATTTTGGATGG - Intergenic
975900303 4:79143542-79143564 TTTAAGAAATAAATTTTGGAAGG - Intergenic
976389477 4:84494005-84494027 TTTTCGGTATAGATTGTGGGGGG + Intronic
976885276 4:89975575-89975597 TTTAAGGAATACATTTTGTAAGG - Intergenic
977207564 4:94180311-94180333 TTTGAGGTACAGACTTTTGATGG - Intergenic
977875039 4:102139633-102139655 TTTCAGAAATAGATCTTGGATGG + Intergenic
978281421 4:107020079-107020101 TTTTAGGTCTTAATTTTGTAAGG + Intronic
978779514 4:112535751-112535773 TGTTATGTATAGATGTTTGATGG + Intergenic
979871154 4:125823810-125823832 TTTTAAGTAAAAATTTTTGAAGG + Intergenic
980803396 4:137782262-137782284 TTTTCAGGATACATTTTGGAAGG - Intergenic
981010404 4:139919461-139919483 TTTTATGTAGAAAGTTTGGATGG + Intronic
981047482 4:140278686-140278708 TTCAATGTATACATTTTGGAGGG + Intronic
981596584 4:146430441-146430463 TTTTATCCATTGATTTTGGAGGG - Intronic
981688220 4:147479146-147479168 TTTTATGTTTAATTTTTGGAGGG + Intergenic
982564036 4:156966859-156966881 TTTTAATCATAGATATTGGATGG - Intronic
982781087 4:159492190-159492212 ATTTAGATATAAAATTTGGATGG + Intergenic
982867333 4:160531272-160531294 TTTTAGTTATTATTTTTGGAAGG + Intergenic
982909711 4:161124386-161124408 TTTTTTGTAAACATTTTGGATGG + Intergenic
983483667 4:168307298-168307320 CTTTAGGTATAGGATTAGGAAGG + Intronic
983752750 4:171297794-171297816 ATTTAGGATTTGATTTTGGAAGG - Intergenic
984110755 4:175610424-175610446 CTTTATGTCCAGATTTTGGAGGG + Intergenic
984672648 4:182509300-182509322 TTCTAGGTATAGATTCTTGTGGG + Intronic
986174594 5:5341238-5341260 TTTGGGGTATGGATTTGGGATGG - Intergenic
987311268 5:16683385-16683407 TTTTTGGTTTTGATTTTTGAAGG - Intronic
987935119 5:24453604-24453626 TTTTAGGTATAAGTTTTTCATGG - Intergenic
990112199 5:52340518-52340540 TTTAAGAAATACATTTTGGAAGG + Intergenic
990513283 5:56508864-56508886 TTTTTGGGATTTATTTTGGATGG - Intergenic
991045112 5:62214303-62214325 ATTAAGCTATACATTTTGGAGGG - Intergenic
991165945 5:63565597-63565619 TTTTAGGTGTGCATATTGGAGGG + Intergenic
992567846 5:78018898-78018920 TTTTAGTTATAGATTTCAGCAGG - Intronic
992633272 5:78701995-78702017 TCTTCTGTATTGATTTTGGATGG - Intronic
992808530 5:80362379-80362401 TTATAGGTACAGATTTTTGATGG - Intergenic
992818725 5:80471920-80471942 TTTTGCCTATAGATTTTGTAAGG + Intronic
993092220 5:83440555-83440577 TTTTAGATGAAGATTTTGGATGG + Intergenic
993355759 5:86905401-86905423 TTTCAGGTATACTTTTTGCAGGG - Intergenic
993756747 5:91740561-91740583 TTCTAGGTACAGATTTTAAAAGG - Intergenic
993776661 5:92008359-92008381 TTTTAGCTGTAGTTTTTGGTGGG - Intergenic
994308209 5:98234124-98234146 TTTTAGGGATAGATTTTATTTGG - Intergenic
994505002 5:100631334-100631356 TATTAAGTATAAATTTTGGCCGG - Intergenic
997407413 5:133662523-133662545 TTTTAGGAAAACATTTTGGCAGG - Intergenic
997855349 5:137368121-137368143 TGTTAGGTACAGATGTTTGAGGG - Intronic
998713616 5:144854318-144854340 TTTTAGCTATAGAATTTGGTAGG + Intergenic
999313321 5:150567868-150567890 CTTTAGGTATAGACGTAGGAGGG + Intergenic
1001391245 5:171380988-171381010 TTTGATGTACATATTTTGGACGG + Intergenic
1002574567 5:180166061-180166083 TTTTTGGTATAGTTTTTTCATGG + Intronic
1004038638 6:11951392-11951414 TTTTTGATATAAATTGTGGAGGG + Intergenic
1004363805 6:14995277-14995299 TCTTGGGTAAAGATCTTGGAAGG - Intergenic
1005143010 6:22655696-22655718 ATTTATGTATAGCTTCTGGAAGG + Intergenic
1005155650 6:22803074-22803096 TTTTAGATGGAGATTTTAGATGG - Intergenic
1008120680 6:47613323-47613345 TTTAAGATACACATTTTGGAAGG - Intronic
1008955908 6:57215334-57215356 GTTTAGGTCTAGATTTTGACTGG - Intronic
1009261601 6:61497183-61497205 GTTTATGGACAGATTTTGGAGGG + Intergenic
1009518315 6:64648743-64648765 ATTTAGGAATGGATTCTGGAGGG + Intronic
1009692494 6:67054421-67054443 AATTTGGTACAGATTTTGGAGGG - Intergenic
1009945040 6:70333342-70333364 TTTCTGGTTTAGATTTGGGAGGG + Intergenic
1011379213 6:86724551-86724573 TTTTAGGCACAGATTCTTGAAGG + Intergenic
1012138507 6:95590512-95590534 TTTTATGTATAAATTTTTAAAGG - Intronic
1013266381 6:108503297-108503319 TTTAAGAAATACATTTTGGAAGG - Intronic
1013340344 6:109208096-109208118 TTCTAGTTATAGGTTTTAGAGGG + Intergenic
1014020895 6:116588066-116588088 GTTTAGTCATAGATTTAGGATGG + Intronic
1014168881 6:118255910-118255932 TCTAAGGTATAGGGTTTGGAAGG + Intronic
1014340184 6:120195606-120195628 TTTTATGCAGATATTTTGGATGG - Intergenic
1014472512 6:121834044-121834066 TTTCAGGCATAGATATTCGAAGG - Intergenic
1016554940 6:145325939-145325961 TTGCAGGTATACATTGTGGAAGG + Intergenic
1016696376 6:147000841-147000863 CTTTAAGTGTAGAGTTTGGAAGG - Intergenic
1016769040 6:147828228-147828250 TTTTAGGAAAAGAATTTGTATGG - Intergenic
1017287856 6:152698350-152698372 TATTAAGTACAGATTTTGGCTGG + Intronic
1017557521 6:155587894-155587916 TTCTATGTATAGATTTTGGGGGG - Intergenic
1017738738 6:157385818-157385840 TTAAAGGCATGGATTTTGGAAGG + Intronic
1019068766 6:169324637-169324659 TTTAATACATAGATTTTGGAGGG + Intergenic
1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG + Intronic
1020727735 7:11836950-11836972 TTTAAGGAATATATTTTGTAAGG + Intergenic
1022105856 7:27197675-27197697 TTTTATGTATAGATTTAGAGGGG - Exonic
1023804323 7:43860885-43860907 TTTTACAAATAGATTTTTGAGGG + Intergenic
1024139792 7:46450265-46450287 TTTTGGTTTTGGATTTTGGAAGG - Intergenic
1024466410 7:49716057-49716079 TTTTAGGCTTTAATTTTGGAAGG - Intergenic
1024776955 7:52798821-52798843 TTTTTGGCATAGCTTTAGGATGG - Intergenic
1025143084 7:56482066-56482088 TTTTATTTATATTTTTTGGACGG - Intergenic
1025273216 7:57545972-57545994 TACTAGATATAGATTTTGGTTGG - Intergenic
1025749255 7:64278386-64278408 TTTTAGGTATCTATTCAGGAGGG + Intergenic
1027626850 7:80555685-80555707 TTTGAGGTATATAATTTGTATGG + Intronic
1027901738 7:84124728-84124750 TTTTAGAAATAGCTATTGGATGG - Intronic
1028866171 7:95716301-95716323 TTTTAGTTACACATATTGGAAGG - Intergenic
1028971836 7:96867911-96867933 ATTTAAGGATAGATTTTGGATGG + Intergenic
1030568210 7:111187429-111187451 TTTTAGCTATATATTTTAAAAGG - Intronic
1030655449 7:112162462-112162484 TTTTGTGTATAGATGTTGGGAGG + Intronic
1031179870 7:118400304-118400326 GCTCAGGTATAGATTTTGGAGGG - Intergenic
1031215946 7:118891436-118891458 TTTTATGATTAGATTTTGGAAGG + Intergenic
1031332577 7:120484256-120484278 TTTTACTTTTAGATTTAGGAAGG + Intronic
1032556447 7:132840727-132840749 TTCTAGGTATAGATTCTAAATGG + Intronic
1032768955 7:135028801-135028823 TTTAAGAAATAGATTTTGTAAGG - Intronic
1035184517 7:157115726-157115748 TTTTAGGTTTACACTTTGGGAGG + Intergenic
1036531596 8:9594198-9594220 TTTTAAGTATAGTATTTTGAAGG + Intronic
1037506395 8:19534035-19534057 TTTTAAATTTAGATTTTGAAAGG - Intronic
1038067962 8:23983300-23983322 TTTTTGCTGAAGATTTTGGACGG - Intergenic
1038348113 8:26750611-26750633 TTTAACATATGGATTTTGGAGGG + Intronic
1038955787 8:32467100-32467122 TTTCAGATATAGAATTTGCAAGG + Intronic
1041104669 8:54429631-54429653 TTTTATGTTTGGATTTTGGTTGG - Intergenic
1041197282 8:55412606-55412628 TTTTGTGAATAAATTTTGGAGGG - Intronic
1041500930 8:58537719-58537741 TTTTAAGTATAGTTTTTAAATGG + Intergenic
1041621284 8:59972564-59972586 TTTAAGATATGGATTTTGGAGGG + Intergenic
1041803301 8:61822987-61823009 TTTGAGAAATAGATTTTTGAAGG - Intergenic
1041941752 8:63396019-63396041 TTTCTGGTATAGATCTTTGATGG + Intergenic
1042755474 8:72205752-72205774 TTCTATATATACATTTTGGATGG + Intergenic
1042989898 8:74627524-74627546 TTTTTGGTTTAGATTTTTTAAGG + Intronic
1042997677 8:74718909-74718931 TTTAACGTATTAATTTTGGAGGG + Intronic
1043857672 8:85279956-85279978 TTTTAAGTACAGATATGGGAAGG - Intronic
1044208289 8:89518352-89518374 TTTAAGACATAAATTTTGGAGGG + Intergenic
1044256703 8:90071706-90071728 TGTTATGTATACATTTTGGAGGG + Intronic
1044297841 8:90548987-90549009 TTTTAATTTTAGATTTTGGGGGG - Intergenic
1044870073 8:96610854-96610876 GTCTAGGTAGAGATATTGGAAGG + Exonic
1045267232 8:100630133-100630155 TTGGAGGTTTAGATTTTAGATGG - Intronic
1045422010 8:102025775-102025797 CTACAGGTATACATTTTGGAGGG + Intronic
1045744435 8:105400657-105400679 ATTTAGGTATATATTTAGGTTGG + Intronic
1045773520 8:105774116-105774138 TTTTCTGCATAGATTATGGAAGG - Intronic
1045853329 8:106730689-106730711 TTTTAGATGTAGATTTTGTGTGG + Intronic
1046331039 8:112715354-112715376 TTTCTGGTTTAGTTTTTGGAGGG - Intronic
1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG + Intergenic
1047131060 8:122019911-122019933 TTTTGGGTTTAGATTTTAGCTGG + Intergenic
1048030372 8:130626025-130626047 TTTTAGATAAATATTTTGGGAGG - Intergenic
1048358861 8:133677538-133677560 GTTTAGATATACATTTTAGAAGG + Intergenic
1051874089 9:21772316-21772338 TGCTAGGTATAGAGTTTGAAAGG + Intergenic
1053720530 9:40941999-40942021 TTGAAGCTATATATTTTGGAGGG + Intergenic
1055258844 9:74408080-74408102 TTTCAGTTAGAGATTTAGGATGG - Intergenic
1055402278 9:75936875-75936897 TTTAAGAAATAGATTTTGTAAGG - Intronic
1055939108 9:81632424-81632446 TTTTTGGTATAAGTTTTGGGGGG - Intronic
1057066329 9:92055575-92055597 TTTTAGGAATAAATCTTGTAAGG - Intronic
1057115820 9:92520598-92520620 TTTTGGGTATATACTTAGGAGGG - Intronic
1059572697 9:115457582-115457604 TGCTAGGTATAGATTCTGAAGGG - Intergenic
1187165767 X:16802703-16802725 TTTTAAGTTGAGATTTTGGTTGG - Intronic
1187191493 X:17039495-17039517 GTTTAGTTTTAGATTTTGGCTGG - Intronic
1187469856 X:19559675-19559697 TTTTTGGTATATAATTTGCAAGG - Intronic
1188960447 X:36484913-36484935 TTTGAAGTATAGAGTTAGGATGG + Intergenic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1189784792 X:44549784-44549806 TTTTAGGAGTAGTTTATGGAGGG - Intergenic
1190260794 X:48795635-48795657 TTTAAGGAGTGGATTTTGGATGG + Intergenic
1191860969 X:65666629-65666651 TTTTTTGTATAGATATGGGAGGG + Intronic
1192098861 X:68242560-68242582 TTTTGGGTATATACTTTGGAGGG - Intronic
1192936121 X:75859894-75859916 TTCTTGGTGTAGACTTTGGAGGG + Intergenic
1193327062 X:80190877-80190899 TTCTTGGTTTAGATTTGGGAGGG - Intergenic
1193555034 X:82943294-82943316 TTTTAGATATAGAATTTGTGGGG + Intergenic
1196122643 X:112067211-112067233 TTGTAGGTAGATATTTTGCAGGG + Intronic
1197857373 X:130930185-130930207 TTTTTGGTACAGATTTTGTCTGG - Intergenic
1198050631 X:132949816-132949838 TTTTATGCTTAGATTTGGGAGGG + Intronic
1198115196 X:133538130-133538152 TTGTAGGTATTTATTTTGGAAGG - Intronic
1198607649 X:138360202-138360224 GATTAGGTTTACATTTTGGAAGG + Intergenic
1198644438 X:138790436-138790458 TTTTAGGGTTGGATATTGGATGG - Intronic
1198650554 X:138859302-138859324 TTTTATTTAAATATTTTGGATGG - Intronic
1198761219 X:140034500-140034522 TGTTCTGTATTGATTTTGGAGGG - Intergenic
1199340497 X:146671564-146671586 TTTAAGCTCTAGAGTTTGGAGGG + Intergenic
1200692830 Y:6325018-6325040 TTCCTGGTTTAGATTTTGGAGGG - Intergenic
1201042442 Y:9849708-9849730 TTCCTGGTTTAGATTTTGGAGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201395872 Y:13548143-13548165 TATTAATTTTAGATTTTGGAAGG - Intergenic
1201524940 Y:14922416-14922438 TATAAGGTATATATTTTGGTAGG - Intergenic