ID: 1099725897

View in Genome Browser
Species Human (GRCh38)
Location 12:86427497-86427519
Sequence CTGTGTGTGTGTAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1360
Summary {0: 1, 1: 1, 2: 11, 3: 135, 4: 1212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099725897_1099725900 30 Left 1099725897 12:86427497-86427519 CCATCCACCTTACACACACACAG 0: 1
1: 1
2: 11
3: 135
4: 1212
Right 1099725900 12:86427550-86427572 ACACACCCTCTTATCCATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099725897 Original CRISPR CTGTGTGTGTGTAAGGTGGA TGG (reversed) Intronic
900116462 1:1031091-1031113 GTGTGTGTGTGTGCGGTGCATGG + Intronic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
900293303 1:1934603-1934625 ATGTGTGTGTGTTAGGTTGTAGG + Intronic
900436808 1:2634846-2634868 CTGTGTGGGTGTTGGGGGGATGG - Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
901293692 1:8144595-8144617 GTGTGTGTGTGTGAGATGGATGG + Intergenic
901527222 1:9831170-9831192 TTGTGTGTGTGTGTGGTGGTGGG + Intergenic
901831800 1:11897302-11897324 GTGTGTGTGTGTCGGGGGGAGGG - Intergenic
902091535 1:13907495-13907517 CTGTGTGTGTGTGTGTTGGGTGG + Intergenic
902091537 1:13907499-13907521 GTGTGTGTGTGTTGGGTGGGTGG + Intergenic
902646395 1:17802437-17802459 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
902705958 1:18204630-18204652 TTGTGTGTTTGTAAACTGGATGG - Intronic
902810225 1:18883851-18883873 CTCGGTGTGTGGGAGGTGGATGG + Intronic
902836789 1:19052751-19052773 GTGTGTGTGTGTATGGAGAAGGG - Intergenic
903184440 1:21621408-21621430 CTGTGTGTGTGTGCGGGTGAGGG - Intronic
903188496 1:21642865-21642887 GTGTGTGTGTGTAGTGGGGAAGG - Intronic
903407658 1:23111768-23111790 TGTTGTGTGTGTAAGGTGGGTGG - Intronic
903757500 1:25672791-25672813 CTGTGTGTGTTTGAGGTGATGGG + Intronic
903771794 1:25768926-25768948 GTGTGTGTGTGTAGTGTGTAAGG - Intronic
903951179 1:26996796-26996818 GTGTGTGTGTGTGAAGTAGAGGG + Intronic
904016861 1:27428430-27428452 TTCTGTGTGTGTAAAGTGGGAGG - Intronic
904568899 1:31445777-31445799 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
904913526 1:33953214-33953236 ATGTGTGTCTCCAAGGTGGAAGG + Intronic
905253016 1:36661823-36661845 CTCTGTATATGTTAGGTGGAAGG + Intergenic
905508427 1:38499185-38499207 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
905546884 1:38807281-38807303 GTGTGTGTGTGTCAGGGAGAAGG - Intergenic
905587969 1:39136445-39136467 CTGTTTGTTTATAGGGTGGAAGG + Intronic
905720922 1:40201046-40201068 GTGTGTGTGTGTGAGGTGTGGGG - Intronic
906143206 1:43545799-43545821 CTGTGTGTGTTTGTGTTGGAGGG + Intronic
906398387 1:45486772-45486794 GTGTGTGTGTGTATGCTGGGAGG - Intronic
906479318 1:46189800-46189822 CAGTATGTGTGTGAGGGGGAGGG + Intronic
906667551 1:47632269-47632291 CTGAGTGTGTGTATGTTGGGGGG - Intergenic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907243967 1:53095593-53095615 CAGTGTGTGTGTAACGAGGCGGG - Intronic
907423760 1:54365350-54365372 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907663476 1:56414557-56414579 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
907756005 1:57311515-57311537 GTGTGTGTGTGTGTGGTGGTTGG - Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908313041 1:62904750-62904772 GTGTGTGTGTGTAAGGGGGGTGG + Intergenic
908470983 1:64443726-64443748 GTGTGTGTGTGTCGGGTGGCGGG - Intergenic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909361024 1:74758828-74758850 GTGTATGTGTGTAAGGTTGGGGG - Intronic
909616488 1:77615924-77615946 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
909914806 1:81303569-81303591 CTGTGTGGGGGTAATGAGGATGG - Intergenic
910040587 1:82846844-82846866 GTGTGTGTGTGTAAATTGGGGGG - Intergenic
910227103 1:84947299-84947321 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
910229383 1:84970268-84970290 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
910896123 1:92071255-92071277 GTGTGTGTGTGTATGGGGTAGGG - Intergenic
911761707 1:101624839-101624861 GTGTGTGTGTGTAAGGAGCAAGG + Intergenic
912249459 1:107995716-107995738 TTGTGTGTGTGTGAGGGGAAGGG + Intergenic
912442890 1:109712476-109712498 CTGTGTGTGTGTTTGGGGGTGGG + Intronic
912535495 1:110366091-110366113 GTGTGTGTGTGTAAAATGAAAGG - Intronic
912602289 1:110949087-110949109 GTGTGTGTGTGTGGGGTGGGCGG + Intronic
912669415 1:111610523-111610545 GTGTGTGTGTGTTGGGTGGAGGG - Intronic
912679788 1:111721808-111721830 GTGTGTGTGTGTGTGGTGGCGGG + Intronic
912803953 1:112741391-112741413 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
913333379 1:117685692-117685714 ATGTGTGTGTGTATGCTTGAAGG + Intergenic
913370115 1:118089341-118089363 GTGTGTGTGTGTGTGGTGGCAGG + Intronic
914925095 1:151878283-151878305 CTATGTGTGTGTGGAGTGGAGGG - Intronic
915167078 1:153953980-153954002 GGGTGTGTGTGTAAGGGGGAGGG - Intronic
915874409 1:159597252-159597274 GTGTGTGCTTGTAAGGGGGATGG + Intergenic
915943531 1:160134205-160134227 TTGTGTGTGTGTGAGGGGGTGGG - Intronic
915979408 1:160410663-160410685 GTGTGTGTGTATAAGGGGGGTGG - Intronic
916001618 1:160621876-160621898 GTGTGTGTGTGTAAAATGGAGGG + Intronic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916435812 1:164776921-164776943 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
916559224 1:165918555-165918577 CTGTGGGTGTGTATGGTGAGTGG + Intergenic
916652206 1:166842836-166842858 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
916655411 1:166870981-166871003 CTGTGTGTGTTTAACGGAGAGGG + Intronic
916720115 1:167478473-167478495 ATGTGTGTGTGTTTGGTGGGGGG + Intronic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
917309415 1:173663048-173663070 GTGTGTGTGTGTGTGTTGGAAGG - Intronic
917430456 1:174962198-174962220 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
917463665 1:175255155-175255177 ATGTGTGTGTGTGGGGTGGGTGG + Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917845599 1:179017503-179017525 CTGTGTTTGCGTATGGAGGAAGG + Intergenic
918102908 1:181391969-181391991 GTGTGTGTGTGTTTAGTGGAAGG + Intergenic
918422882 1:184381940-184381962 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
918473284 1:184897304-184897326 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
918771190 1:188562527-188562549 CAGTGTGGGTGTGAGGAGGAGGG - Intergenic
919790115 1:201285213-201285235 GTGTGTGTGTGTGTGGTGGAAGG - Intronic
919813196 1:201421830-201421852 GTGTGTGTGTGAAGGGTGGGAGG - Intronic
919924230 1:202184178-202184200 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
920044384 1:203124161-203124183 CTGTGTGTTTGTGAGGCGGTGGG - Intronic
920260695 1:204685833-204685855 GTGTGTGTGCGTTAGGTAGAGGG - Intergenic
920842398 1:209565733-209565755 CTGACTGTGAGTCAGGTGGATGG - Intergenic
921205246 1:212843090-212843112 GTGTGTGTGTGTATGTTTGACGG - Intronic
921253207 1:213316719-213316741 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
921280109 1:213558033-213558055 GTCTGTGTGTGTAACATGGAAGG - Intergenic
921348771 1:214214164-214214186 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
921613175 1:217236084-217236106 GTGTGTGTATGTGAGGTGGGAGG + Intergenic
921973176 1:221173334-221173356 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
922126887 1:222736539-222736561 CAGTGTGTGTGTCAGGGGCAAGG - Intergenic
922244622 1:223783491-223783513 TTGTGTGTGTGCAAGGGGCATGG - Intronic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922493044 1:226033972-226033994 ATGTCTGTGTCTCAGGTGGAAGG + Intergenic
922591790 1:226782968-226782990 GTGTGTGTGTGTAAGATGCCAGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922987281 1:229875511-229875533 GTGTGTGTGTGTAGGGGGAAGGG - Intergenic
923464744 1:234238253-234238275 ATGTGTGTGTGTATGGGGCATGG - Intronic
923624139 1:235600444-235600466 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
923869090 1:237971560-237971582 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
924081283 1:240400797-240400819 TTGTGTGTGTGTGTGGTGGTCGG - Intronic
924098411 1:240578539-240578561 CTTTGTGAGTCTGAGGTGGATGG + Intronic
924286976 1:242497472-242497494 TTGTGTGTGTGTATGGAGGCAGG + Intronic
924305254 1:242681140-242681162 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1063039242 10:2319984-2320006 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1063120386 10:3101760-3101782 CTATCTGTGTGAAAGGTCGAAGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063518862 10:6722840-6722862 GTGTGTGTGTGTGTGGTTGAGGG + Intergenic
1063859699 10:10294265-10294287 GTGTGTGTGTCTATGGTGAATGG + Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064173068 10:13051032-13051054 CTTTGAGTGGCTAAGGTGGAAGG - Intronic
1064223922 10:13465889-13465911 GTGTGTGTGTGTGTGGTGGCAGG + Intronic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065235750 10:23649811-23649833 GTGTGTGTGTGTAAGCAGAAAGG - Intergenic
1066360726 10:34727807-34727829 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1066360735 10:34727871-34727893 GTGTGTGTGTGTGTGGCGGAGGG - Intronic
1066507922 10:36064926-36064948 ATGTTTGTGTGTAAGGGAGAAGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067336610 10:45371420-45371442 TTGTGTGTGTGTATGTTGGGGGG - Intergenic
1067390703 10:45860503-45860525 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1067823740 10:49553861-49553883 GTGTGCGTGTGTATAGTGGAAGG + Intergenic
1067878057 10:50021507-50021529 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1068004025 10:51371414-51371436 CTGTGTGTGTGTGAGTCTGAGGG + Intronic
1068918834 10:62462188-62462210 CTGTGTGTGTGTGTGTGGGAGGG - Intronic
1069040675 10:63692639-63692661 GTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1069465910 10:68638797-68638819 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1070137890 10:73710738-73710760 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1070198921 10:74184533-74184555 GTGTGTGTGTGTCAGGGGGGTGG + Intronic
1070218851 10:74418681-74418703 CTGTGTGTGTTTAAAGGGGTGGG - Intronic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070534124 10:77362356-77362378 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1070540048 10:77409315-77409337 CTGTGTGTGTGGTAGTTGGGTGG - Intronic
1070631406 10:78087568-78087590 GTGTGTGTGTGTAAGCTTGGTGG + Intergenic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1070937443 10:80312037-80312059 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1071234642 10:83631246-83631268 GTGTGTGTGTGTAGGGTGGGAGG + Intergenic
1071663953 10:87535128-87535150 CTGTGTGGATGTAAGATGTAAGG + Intronic
1072004235 10:91227763-91227785 ATGTGTGAGTGTTAGGTGGTAGG - Intronic
1072265951 10:93728174-93728196 CTCTGTGTGTGTAAACTGGAAGG - Intergenic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1072752194 10:97989271-97989293 CTGTGTGTGCGTTGGGTGGGGGG - Intronic
1073051225 10:100668618-100668640 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1073113354 10:101076076-101076098 CTGTGTGTGTGTATTGTGGGGGG - Intergenic
1073146186 10:101283714-101283736 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073660505 10:105470892-105470914 GTGTGTGTGTGTAAGATTCAGGG - Intergenic
1073957084 10:108884882-108884904 GTGTGTGTGTGTAAGGAGGCAGG + Intergenic
1073982364 10:109169076-109169098 ATGTGTGTGTGTGTGGTGGTGGG - Intergenic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1076122614 10:127948311-127948333 CTGTGTGTGTGTAGGGTTAAGGG - Intronic
1076189312 10:128471431-128471453 GTGTGTGTGTGTGGGGGGGATGG - Intergenic
1076288726 10:129327133-129327155 TGTGGTGTGTGTAAGGTGGAAGG + Intergenic
1076405241 10:130207802-130207824 TTGTGTGTGTGTGAGATGGTGGG - Intergenic
1076856925 10:133121346-133121368 CTGTGTGTGTGGAATGTGCCAGG + Intronic
1076865991 10:133166568-133166590 GTGTGTGTGTGTGAAGCGGATGG + Intronic
1076900975 10:133337241-133337263 GTGTGTGTGTGTCAGGTGTTTGG - Intronic
1076984115 11:223255-223277 CTGTGTGTGTCTGAGGTGTCGGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077315000 11:1915625-1915647 CTGTGTGTGTGTGTTGTGGGGGG + Intergenic
1077320685 11:1939646-1939668 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077372097 11:2187231-2187253 CTGTGTGTGTGTGTGGTGTGTGG - Intergenic
1077489570 11:2854465-2854487 GTGTGTGTGTGTAGGGTTGTAGG - Intergenic
1077877412 11:6319996-6320018 ATGTGGGTGTGGTAGGTGGATGG + Intronic
1077980656 11:7296996-7297018 TTGTGTGTGTGTCAGGGGGAGGG - Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078350126 11:10586154-10586176 CTGTGTGTGTGTGTGGAGGGTGG + Intronic
1078421717 11:11218092-11218114 CTGTGTGTATGTGTGGTGCAGGG - Intergenic
1078488917 11:11751256-11751278 CTGTATGTGTGTGGGGTGGGTGG - Intergenic
1078722298 11:13896381-13896403 GTGTGTGTGTGTATCGGGGAGGG + Intergenic
1079394098 11:20046587-20046609 GTGTGTGTGTGTGATGGGGAGGG - Intronic
1079430997 11:20388004-20388026 GTGTGTGTGTGTTAGGCGGCCGG + Exonic
1079661884 11:23048327-23048349 TTGGGTGTGTGTAAGGATGAGGG - Intergenic
1079701392 11:23553008-23553030 CTCTGTGTGTGTGAGGGGGTGGG + Intergenic
1080028555 11:27637190-27637212 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1080305309 11:30828705-30828727 GTGTGTGTGTATGTGGTGGAGGG - Intergenic
1080641399 11:34160605-34160627 CTGTGTGTGTGTGTGTTGGGTGG + Intronic
1080641403 11:34160609-34160631 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080641437 11:34160727-34160749 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080925056 11:36747609-36747631 TTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1081049697 11:38322969-38322991 GTGTGTGTGTGTGTGGTGGGAGG + Intergenic
1081408164 11:42722372-42722394 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1081602412 11:44504383-44504405 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081602419 11:44504468-44504490 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081602443 11:44504707-44504729 GTGTGTGTGTGTAGAGTGTATGG - Intergenic
1081604256 11:44517545-44517567 GTGTGTGTGTGTAAAGAGAATGG + Intergenic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1082974150 11:59055590-59055612 ATGTGTGTGTGTATGTTGGGTGG - Intergenic
1082987293 11:59179893-59179915 GTGTATGTGTGTAGGGTGGTAGG - Intronic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1083181304 11:60987576-60987598 TGGTGTGTGTGTATGGTGGGGGG + Intronic
1083296442 11:61717987-61718009 GAGTGTGTGTGTTGGGTGGATGG + Intronic
1083374038 11:62205314-62205336 GGGTGTGTGTGTAAGGGGAAGGG + Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083710938 11:64547918-64547940 ATGTGTATCTGTTAGGTGGAAGG + Intergenic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1084035126 11:66504963-66504985 CTGTGTGTGTGTCGGGGGGGTGG - Intronic
1084215406 11:67644725-67644747 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1084329388 11:68421738-68421760 GTGTGTGTGTGTATGGGGGAGGG + Intronic
1084506032 11:69568913-69568935 CTGTGTGTGTGCACTGTGTATGG + Intergenic
1084536549 11:69760798-69760820 CTGTGAGTGTGTCAGGGGGAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085204003 11:74719371-74719393 GTGTGTGTGTGTACAGGGGAGGG - Intronic
1085341233 11:75732890-75732912 CTGTTTGTGGGTAGGCTGGAGGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085448274 11:76615539-76615561 GTGTGTGTGTGTTGGGGGGATGG - Intergenic
1085500661 11:77019797-77019819 CTGTGTGTGTGTTGGGGGTATGG + Intronic
1086000101 11:81973224-81973246 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1086189975 11:84067549-84067571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1086864756 11:91966924-91966946 CTGTGTTTTTGTGAGGTGAAGGG + Intergenic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1086928226 11:92664017-92664039 GTGTGTGTGTGTTTGGGGGAGGG - Intronic
1087242649 11:95797165-95797187 CTGTGTGTGTGTGTGTTGGGAGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088010802 11:104998702-104998724 ATGTGTGTGTGGGAGGGGGAAGG + Intronic
1088200719 11:107330637-107330659 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1088344555 11:108808045-108808067 ATGTGTGTGAGTATGGTGAAAGG + Intronic
1088464047 11:110114238-110114260 ATGTGTCTGTGTTAGGTAGAAGG - Intronic
1088727224 11:112649997-112650019 GTGTGTGTGTGTGATGGGGATGG + Intergenic
1089291855 11:117442516-117442538 GCGTGTGTGTGTATGGGGGAAGG + Intronic
1089318930 11:117611977-117611999 CTGTTTGTGTGTTGGGGGGATGG - Intronic
1089391509 11:118105078-118105100 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089640110 11:119842479-119842501 GTGTGTGTGTGAAGGATGGAGGG - Intergenic
1089665487 11:120015339-120015361 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1090002550 11:122975144-122975166 GTGTGTGTGTGTAAATTAGATGG - Intergenic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090397460 11:126428525-126428547 ATGTGTGTGTGTGCGGGGGAGGG + Intronic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1090942612 11:131400968-131400990 GTGTGTGTGTGGCAGGTGGCAGG - Intronic
1091155682 11:133369689-133369711 ATGTGTGTGTGTATGGTGAATGG - Intronic
1091170789 11:133518180-133518202 ATGTATGTGTGTAATGTGTATGG + Intronic
1091170804 11:133518288-133518310 ATGTATGTGTGTAATGTGTATGG + Intronic
1091249801 11:134133764-134133786 AGGTGTGTGTGTAGGGGGGAAGG - Intronic
1091332968 11:134744881-134744903 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091534556 12:1393638-1393660 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1091658043 12:2360168-2360190 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1091696000 12:2628506-2628528 CTAGGTGTGTGAAAGGAGGAAGG - Intronic
1091799513 12:3316089-3316111 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1091877066 12:3944175-3944197 GTGTGTGTGTGTATGTTGGGGGG - Intergenic
1092119134 12:6031716-6031738 CTCTGTGTGTGTCTGGGGGACGG + Intronic
1092272829 12:7037154-7037176 CTGTGTGTGTGTGTGTTGGCGGG + Intronic
1092351547 12:7760014-7760036 GTGTGTGTGTGTGATGTGGGGGG - Intergenic
1092985648 12:13843220-13843242 GTGTGTGTGTGTGATGTGTATGG - Intronic
1093112667 12:15170332-15170354 CTGGGTGTGTGTAGGGGGAAGGG + Intronic
1093508219 12:19894459-19894481 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1093544029 12:20323872-20323894 CTGTGTGTGTGTATGAGAGAGGG + Intergenic
1093546926 12:20359632-20359654 GTGTGTGTGTGTGAAGTGGGTGG - Intergenic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093702321 12:22235885-22235907 GTGTGTGTGTGTGTGGTGAAGGG - Intronic
1093741480 12:22693752-22693774 CTGTGTGTGTGTGTGTTGGGGGG + Intergenic
1093776948 12:23086756-23086778 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1093960924 12:25271985-25272007 GTGTGTGTGTGTAAGGGCCATGG + Intergenic
1094078820 12:26509990-26510012 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1094794844 12:33959847-33959869 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095082696 12:38025766-38025788 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095094157 12:38136406-38136428 CTTTGGGAGTCTAAGGTGGAAGG + Intergenic
1095130977 12:38541933-38541955 GTGTGTATGTGTTGGGTGGATGG + Intergenic
1095958724 12:47820445-47820467 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1096079090 12:48822112-48822134 GTGTGTGTGTGTATAGGGGAAGG - Intronic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096270310 12:50160878-50160900 CTGAGTGTGTGTAAGAGGAAAGG + Intronic
1096467071 12:51852481-51852503 CTGTGTGACTGTAAGGTACATGG - Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096539883 12:52301088-52301110 GTGTGTGTGTGTGAGATGGTGGG + Intronic
1096683832 12:53274755-53274777 CAGTGAGTGTGTATGGTGGAAGG - Intronic
1096750637 12:53756740-53756762 GTGTGTGTGTGTACTGGGGAGGG + Intergenic
1096819846 12:54225442-54225464 CTGTGTGTATATAAGTTGGAAGG - Intergenic
1096985328 12:55752360-55752382 CTTTGTGTGTGTGTGGTGGGTGG + Exonic
1097029217 12:56079706-56079728 CTGTGTGTTTTTGAGGGGGAGGG - Intergenic
1097298318 12:57991175-57991197 GTGTGTGTGTGTATAGTGGGGGG + Intergenic
1097933972 12:65224508-65224530 CTGTGTGTGTGTGTGGTAGGGGG - Intronic
1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG + Intergenic
1098177023 12:67803450-67803472 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1098205208 12:68101919-68101941 TTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1098579777 12:72085619-72085641 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1098597801 12:72294356-72294378 CTGTGTGTGTGTGTGGTGGGGGG + Intronic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1099254738 12:80301725-80301747 CTGTATGTGTGTAGGGGGGCAGG - Intronic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1099653919 12:85465277-85465299 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099755014 12:86834605-86834627 GTGTGTGTGTGTGTGGTGGTTGG - Intronic
1099938396 12:89155629-89155651 TTGTGTGTGTTTATGTTGGAGGG + Intergenic
1100445124 12:94652820-94652842 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1100577974 12:95910292-95910314 GTGTGTGTGTGTAATGTAAATGG - Intronic
1100984999 12:100195291-100195313 CTCTGTGTGTGTAGGGGGGCTGG - Intergenic
1101040519 12:100750939-100750961 GTGTGTGTGTGGTAGATGGAGGG + Intronic
1101332580 12:103769107-103769129 GTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1101484031 12:105132820-105132842 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1101510386 12:105387745-105387767 GTGTGTGTGTGTGTGGTGGTAGG + Intronic
1101851219 12:108403953-108403975 CTGGGTGTATGCAGGGTGGAGGG - Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102572744 12:113837234-113837256 GTGTGTGTGTATTAGGAGGATGG - Intronic
1102657406 12:114494219-114494241 CTGATTGTGTGTAAGGTCCATGG + Intergenic
1102968961 12:117150891-117150913 GTGTGTGTGTGTCAGGCGGGAGG + Intronic
1103015219 12:117489152-117489174 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1103143742 12:118575543-118575565 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
1103248591 12:119479985-119480007 GTGTGTGTGTGTATGATGTACGG - Intronic
1103912165 12:124358426-124358448 CTGTGTGTGTGTGTTGTGGCGGG + Intronic
1104610211 12:130221404-130221426 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1104801108 12:131555853-131555875 CTGTGTGTGTGTATGTGGGGGGG - Intergenic
1104876880 12:132041045-132041067 CAGTGGGTGTGTGAGGAGGATGG + Intronic
1104878857 12:132055433-132055455 GTGTGTGTGTGTGTGGTGTAGGG + Intronic
1104878861 12:132055462-132055484 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104878867 12:132055502-132055524 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104878907 12:132055706-132055728 GTGTGTGTGTGTGAAGTGTAGGG + Intronic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105437999 13:20393126-20393148 CTGTGTGTGTGTGGTGTGGCTGG - Intergenic
1105532097 13:21229424-21229446 GGGTGTGTGTGTATTGTGGAGGG - Intergenic
1105547020 13:21358189-21358211 CTGTGCATGTGTAGGGGGGAAGG + Intergenic
1105700709 13:22934390-22934412 GTGTGTGTGTGTGTGGTGCATGG - Intergenic
1106012378 13:25837416-25837438 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
1106110151 13:26770015-26770037 CTTTGAGTGTGTAATGTTGAAGG - Intergenic
1106408058 13:29491037-29491059 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
1106421639 13:29590357-29590379 ATGTGTGTGTGTTTGGTGGGGGG - Intronic
1106674796 13:31947294-31947316 GTGTGAGTGTGTTAGGGGGAAGG + Intergenic
1107282172 13:38749576-38749598 TTGTGTGTGTGTTGGGTGGGAGG + Intronic
1107461192 13:40605414-40605436 ATGTGTGTGTGTAATGCTGACGG - Intronic
1107692091 13:42963619-42963641 GTGTGTGTGTGTATTGGGGAGGG + Intronic
1107846066 13:44514391-44514413 TTGTGTGTGTGTGATGTGGGGGG - Intronic
1108099417 13:46937894-46937916 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1108270840 13:48757899-48757921 GTGTGTGTGTGTCTGATGGAAGG - Intergenic
1108423214 13:50271627-50271649 ATGTGTATGTGTAGGGTGGCTGG + Intronic
1108615931 13:52132065-52132087 CAGCGTATGTGTGAGGTGGAGGG + Intergenic
1108644621 13:52414573-52414595 TTGTCAGTGGGTAAGGTGGAGGG - Exonic
1108965699 13:56297836-56297858 GTGTGTGTGTGTGTGGTGGAAGG - Intergenic
1109064069 13:57661660-57661682 GTGTGTGTGTCTAATGTGTAAGG + Intronic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1109219608 13:59627947-59627969 CTGTGTGTGTGTTTGGTTGTGGG + Intergenic
1109265558 13:60195566-60195588 GTGTGTGTGTGTGAGGAGGGTGG - Intergenic
1109592614 13:64505933-64505955 CTGTGTGTGTGTGTGGAGAAAGG - Intergenic
1109657752 13:65416351-65416373 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1110003552 13:70236824-70236846 GTGTGTGTGTGTAAGGGGGAGGG - Intergenic
1110068614 13:71143354-71143376 CAGTGTTTGTGTCAGGTGGGTGG + Intergenic
1110094014 13:71492767-71492789 ATGTGTGTGTGTATGGTGTGAGG + Intronic
1110204210 13:72892775-72892797 GTGTGTGTGTGTAAGGCAGGAGG - Intronic
1110295245 13:73856527-73856549 CTGGGTGCGTGTATGGAGGAGGG - Intronic
1110700067 13:78536602-78536624 GTGTGTGTGTGTATGTTGGAGGG - Intergenic
1110953407 13:81522423-81522445 CTGTGTGTATCTAATGTAGAGGG - Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1112310425 13:98313303-98313325 GTGTGTGTGTGTTTGGGGGAAGG - Intronic
1112641689 13:101282649-101282671 CTCTGTGTGTGTGGGGTGGGGGG - Intronic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113075453 13:106463596-106463618 GTGTGTGTGTGTAACATGGTTGG - Intergenic
1113327439 13:109295469-109295491 TTGTGTGTGTGTAGGGTTGTGGG - Intergenic
1113454547 13:110438803-110438825 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1113597315 13:111542766-111542788 GTGTGTGTGTGTATGGATGAAGG + Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1113755960 13:112811155-112811177 GTGTGTGTGTGTGTGTTGGAAGG - Intronic
1113901375 13:113800181-113800203 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1115278138 14:31631232-31631254 CTGTGTGTGTGTGGGTTGGGGGG + Intronic
1115344869 14:32331695-32331717 GTGTGTGTGTGTATAGGGGAAGG + Intronic
1115400014 14:32946323-32946345 GTGTGTGTGTGTTGGGGGGATGG - Intronic
1115426867 14:33270471-33270493 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1115549189 14:34489774-34489796 CTGTGTTTTGGTTAGGTGGAGGG + Intergenic
1115671534 14:35617621-35617643 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
1115888726 14:38003713-38003735 ATGTGTGTGTGTGTGGTGGGGGG + Intronic
1116167121 14:41349101-41349123 GTGCGTGTGTGTAAGGGAGAGGG - Intergenic
1116258603 14:42590309-42590331 TTGTGTGGGAGAAAGGTGGAAGG - Intergenic
1116687489 14:48058881-48058903 GTGTGTGTGTGTTTGGGGGAGGG - Intergenic
1116755690 14:48945267-48945289 GTGTGTGTGTGTATGGTGTGTGG + Intergenic
1116983667 14:51196755-51196777 GTGTGTGTGTCTATGTTGGAAGG - Intergenic
1117244516 14:53870888-53870910 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1117557197 14:56897811-56897833 ATGTGTGTGTGTATGGTTGTTGG + Intergenic
1117596638 14:57332565-57332587 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1117659988 14:57993295-57993317 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1117777813 14:59200280-59200302 CTATCTGTGGGTAAGGAGGATGG + Intronic
1118373626 14:65158305-65158327 GTGTGTGTGTGTGAGATGGTAGG + Intergenic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1118853818 14:69605938-69605960 GTGTGTGTGTGTATGTGGGAGGG + Intergenic
1118897759 14:69960403-69960425 CTCTGTGTGTGTTTAGTGGATGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119796883 14:77406580-77406602 GTGTGTGTGTGTAAGGCACAAGG - Intronic
1119852106 14:77873559-77873581 GTGTGTGTGTGTAGGTTGGCTGG + Intronic
1120145891 14:80978088-80978110 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1121029015 14:90641947-90641969 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG + Intronic
1121483649 14:94297054-94297076 ATGTGTGTGTGTATGTTGCAAGG - Intergenic
1121569766 14:94938873-94938895 GTGTGTGTGTGTGTGGTTGATGG + Intergenic
1121746195 14:96295720-96295742 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1121780113 14:96616850-96616872 GAGTGTGTGTGTAAGGGGGGGGG + Intergenic
1121843393 14:97153017-97153039 GTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1121843681 14:97155246-97155268 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
1121963937 14:98287260-98287282 TTCAGTGTGTGTAAGGTGGGCGG + Intergenic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122879472 14:104683605-104683627 CTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1123432116 15:20226790-20226812 CTGGGTGTGTGAGGGGTGGAGGG - Intergenic
1123887925 15:24746362-24746384 CTTTGTGAAAGTAAGGTGGAAGG - Intergenic
1123929171 15:25151458-25151480 CTGTATTTTTCTAAGGTGGAAGG - Intergenic
1123948075 15:25248512-25248534 CTCTGTGTGTGGGAGGTGTAGGG + Intergenic
1124630705 15:31335465-31335487 GTGTGTGTGTGTATGGTGGCGGG + Intronic
1124636822 15:31370937-31370959 CTGCTTGTGTTTAAGGTGGGTGG + Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1124962337 15:34408435-34408457 GTTTGTGTGTGTATGGTGGTGGG - Intronic
1124978961 15:34554657-34554679 GTTTGTGTGTGTATGGTGGTGGG - Intronic
1125419327 15:39488319-39488341 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1125756164 15:42066451-42066473 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1125787959 15:42339299-42339321 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1125932568 15:43611028-43611050 GTGTGTGTGTGTAAGTGGGGAGG + Intronic
1125945666 15:43710490-43710512 GTGTGTGTGTGTAAGTGGGGAGG + Intergenic
1125951048 15:43751702-43751724 AGGTGTGTGTGTAAGCTGCAAGG - Intronic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126270582 15:46812609-46812631 GTGTGTGTGTGTGAGGGGGTGGG - Intergenic
1126338311 15:47611138-47611160 GTGTGTGTGTGTATGTAGGACGG - Intronic
1126419059 15:48452249-48452271 GTGTGTGTGTGTAATGTGTGGGG + Intronic
1126897172 15:53271581-53271603 GTGTGTGTGTGTATGTTGGGGGG + Intergenic
1127226439 15:56935416-56935438 GTATGTGTGTGTATGGTGGGAGG + Intronic
1127420263 15:58798366-58798388 CTTTGAGAGTGTAAGGTGGGTGG - Intronic
1127453773 15:59140076-59140098 GTGTGTGTGTGTATGGGGGTGGG + Intronic
1127619444 15:60719309-60719331 GTGTGTGTGTGTTAGCAGGAGGG + Intronic
1127682226 15:61309054-61309076 GTGTGAGTGTGTGGGGTGGAGGG + Intergenic
1127786591 15:62360932-62360954 GTGTGTGTGTGTGAGGGGAAGGG - Intergenic
1127808363 15:62541596-62541618 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1127966629 15:63927557-63927579 CTGGGTGTGAGTTAGGTGTATGG + Intronic
1128132748 15:65240296-65240318 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1128224486 15:65992437-65992459 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1128761535 15:70219434-70219456 CTGTGTGTGTGAGAGCTGAAAGG + Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1128860907 15:71071163-71071185 GTGTGTGTGTGTGTGTTGGAAGG + Intergenic
1128875708 15:71199439-71199461 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129046817 15:72742809-72742831 CTGTGTGTGTGTAAGAGACAAGG - Intergenic
1129055494 15:72817077-72817099 GTGTGTGTTTGCAAAGTGGAGGG + Intergenic
1129878608 15:78993001-78993023 CTGTGTGTGTGCCATGTGGGTGG + Intronic
1129883720 15:79024296-79024318 GTGTGTGTGTGTATGGTATATGG - Intronic
1130182297 15:81642861-81642883 GTGCGTGTGTGTAGGGAGGAGGG - Intergenic
1130415995 15:83695248-83695270 GTGTGTGTGTGTGTGGTGGTGGG + Intronic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1130856789 15:87846565-87846587 ATGTGTGTGTGAAGGGTGGTTGG + Intergenic
1130881965 15:88062986-88063008 GTGTGTGTGGGTGAGGGGGATGG - Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131037447 15:89232614-89232636 CTGTGTCCTTGCAAGGTGGAAGG - Intergenic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1131313006 15:91307724-91307746 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1131599187 15:93829462-93829484 CTGGGTGTGTGTAGGAGGGAGGG + Intergenic
1131665573 15:94568007-94568029 CTTTTTGTGTGTGTGGTGGAGGG + Intergenic
1131957745 15:97755612-97755634 GTGTGTGTGTGTTGGGTGGGTGG - Intergenic
1131998244 15:98154269-98154291 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1132242785 15:100272584-100272606 CTCTGTGTGTGTAAGATTTAGGG + Intronic
1132836905 16:1958737-1958759 CTGTTTGTCTGTAGGGTTGATGG + Intergenic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1133508985 16:6439786-6439808 AGGTGTGTTTGTAATGTGGAAGG - Intronic
1133589288 16:7227287-7227309 CTGTGTGTGTGTGTGGGGGTGGG - Intronic
1133770312 16:8863831-8863853 GTGTATGTGTGTATTGTGGAGGG - Intronic
1133782067 16:8947350-8947372 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
1134793881 16:17016507-17016529 GTGTGTGTGTGTGGTGTGGAGGG + Intergenic
1134823822 16:17268612-17268634 CTGTGTGTGTGTATTGTGTATGG - Intronic
1134871293 16:17654497-17654519 CTATGTGTATGTGAGGGGGAGGG + Intergenic
1135477893 16:22793906-22793928 CTGTTTGTGTGTGTGGTGGGGGG - Intergenic
1135933174 16:26756868-26756890 GTATGTGTGTGTGGGGTGGATGG + Intergenic
1136351366 16:29710382-29710404 CTCTGTGTGTCTAATGTGCAGGG + Intergenic
1136852522 16:33624349-33624371 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1137270398 16:46899340-46899362 CTGTGTGTGGTTAAGGTTCATGG + Intronic
1137401191 16:48155720-48155742 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1137445066 16:48526645-48526667 CTGTGTGTGTCAGAGGTGCAGGG - Intergenic
1137601761 16:49760909-49760931 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1137776052 16:51055107-51055129 CTGTGTGTGTGTTAGGGGTAGGG + Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1138900254 16:61260490-61260512 ATGTGTGTGTGTGTGGTGAATGG + Intergenic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1139527301 16:67524867-67524889 CTGTGTGTGTGTATGAGGGGAGG - Intronic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140611588 16:76606216-76606238 GTGTGTGTGTGTAAGTTGTGTGG + Intronic
1140741410 16:77944910-77944932 CTGTGTGTGTGTGTGGCGGGGGG - Intronic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1142363739 16:89639139-89639161 GTGTGTGTGTGCAAGGATGAGGG - Intergenic
1142424848 16:89996549-89996571 ATGTGTGTGTGTAAAATGGGTGG + Intergenic
1203114122 16_KI270728v1_random:1472817-1472839 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1142518367 17:448020-448042 TTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1142679061 17:1534973-1534995 CTGCGTGTGTGTGCGGTGGGGGG - Intronic
1142679076 17:1535050-1535072 CTGCGTGTGTGTGCGGTGGGGGG - Intronic
1142759281 17:2033972-2033994 CTGAGTGTGTGTATGGTTGTGGG - Intronic
1142761509 17:2044685-2044707 GTGTGTGTGTGTCAGGGGGTGGG - Intergenic
1143334577 17:6162695-6162717 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1143469233 17:7161395-7161417 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1143615863 17:8048705-8048727 TTGTGTGTGTGTATGGTGGTGGG - Exonic
1143734599 17:8901591-8901613 CTGTGTGTGTTTAATGTGTAAGG + Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1143997454 17:11019601-11019623 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1144009051 17:11127915-11127937 ATGTGTGTGTGTGTGGTGGTTGG + Intergenic
1144117072 17:12106250-12106272 CTGTGTCTGTTTTGGGTGGAGGG + Intronic
1144121368 17:12156991-12157013 CTGTGTGTGTGTCAGGGTGGAGG - Intergenic
1144335055 17:14261219-14261241 CTGTGTGTGTGGTACTTGGATGG + Intergenic
1145000986 17:19304509-19304531 CTTTCTGTGTGTGACGTGGAGGG + Intronic
1145264742 17:21374356-21374378 CTGTGTGTGTGTGTGTGGGAAGG + Intergenic
1146157921 17:30539544-30539566 ATGTGTGTGTGTGTGGTGGGGGG - Intergenic
1146449716 17:32963114-32963136 GTGTGTGTGTGTATGGAGGGAGG + Intergenic
1146462459 17:33057021-33057043 GTGTGTGTGTTTAAGGAGGTGGG + Intronic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1147176724 17:38660461-38660483 CTGTCTGTGTGTCTGCTGGAGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148478396 17:47944223-47944245 GTGTGTGTGTGTGTTGTGGAGGG + Intronic
1148489337 17:48013067-48013089 TAGTGTGTGTGTGATGTGGAGGG - Intergenic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148739269 17:49883044-49883066 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1148894012 17:50829561-50829583 CAATGTCTGTGTGAGGTGGAAGG + Intergenic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1149345353 17:55728794-55728816 GTGTGTGTGTGTAGGGGGTAGGG + Intronic
1149399640 17:56282300-56282322 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1149431571 17:56598327-56598349 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1149536926 17:57440456-57440478 GTGTGTGTGTGTAGCGTGGCTGG + Intronic
1149737218 17:59007152-59007174 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1149775062 17:59350879-59350901 CTGTGTTTGTGTAAGACGGATGG + Intronic
1149823247 17:59801242-59801264 TTGTGTGTGTGTATGTTGAAGGG + Intronic
1150224268 17:63514641-63514663 GTGTGTGTGTGTTAGTGGGAGGG - Intronic
1150495281 17:65603228-65603250 TTCTGTGTGTGTATGTTGGAGGG + Intronic
1150495603 17:65605755-65605777 TTCTGTGTGTGTATGTTGGAGGG + Intronic
1150929269 17:69566464-69566486 CTAGGTGTGTGTGAGGTGGCAGG + Intergenic
1151025007 17:70668369-70668391 ATGTGTGGGTGTAAGGTACATGG + Intergenic
1151163005 17:72181588-72181610 ATGTGTTTGTGTGAGGTGGGAGG - Intergenic
1151174122 17:72273107-72273129 GTGTGTGTGTGTAAACTGGATGG - Intergenic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151599409 17:75097171-75097193 TTGTGTGTGTCTGCGGTGGAGGG - Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152465914 17:80466088-80466110 ATCTGTGTGTGTGAGGTGGGGGG + Intergenic
1153296999 18:3556205-3556227 CTGTGTGTGTGTCGGGGGAAGGG - Intronic
1153368768 18:4289223-4289245 GTGTGTTTGTCTAGGGTGGAAGG + Intronic
1154285086 18:13047350-13047372 GTGTGTGTGTGTATGTTTGAGGG - Intronic
1154492929 18:14934901-14934923 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155172172 18:23275148-23275170 GTGTGTGTGTGCAGGGTGCAGGG + Intronic
1155622384 18:27794647-27794669 GTGTGTGTGTGGGAGTTGGAGGG - Intergenic
1155838818 18:30622560-30622582 GTGTGTGTGTGTAGGGGGCAGGG + Intergenic
1155867264 18:30981329-30981351 TTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1156177498 18:34563971-34563993 GTGTGTGTGTGTAGTGAGGATGG + Intronic
1156194719 18:34761115-34761137 GTGTGTGTGTGAAGGATGGAGGG - Intronic
1156366168 18:36429248-36429270 CTGTGTCTGTCTGAGGGGGATGG + Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156646739 18:39172014-39172036 TTGTGTGTGTGTCAGGAGAATGG - Intergenic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157515474 18:48308148-48308170 GTGTGTGGGTGTGTGGTGGATGG - Intronic
1157535743 18:48456093-48456115 GTGTGTGTGTGTGTGCTGGAGGG + Intergenic
1157650674 18:49327023-49327045 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1157822567 18:50784453-50784475 GTGTGTGTGTGTTTGGAGGAGGG - Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158262352 18:55622140-55622162 GTGTGTGTGTGTAATCTTGAAGG - Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158440510 18:57470764-57470786 TTGTGTGTGTGTGGTGTGGAGGG - Intronic
1159014699 18:63091601-63091623 TTGTGTGTGTGTGTGGTGTATGG + Intergenic
1159079518 18:63721664-63721686 GTGTGTGTGTGTTGGGTGGTAGG + Intronic
1159079526 18:63721716-63721738 GTGTGTGTGTGTCGGGTGGTAGG + Intronic
1159324395 18:66895542-66895564 CTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1159363122 18:67430745-67430767 GTGTGTGTGTGTATGGGGGGGGG + Intergenic
1159568707 18:70087042-70087064 GTGTGTGTGTGTAATCTGAAAGG - Intronic
1159576517 18:70184744-70184766 GTGTGTGTGTGTGTGGTGGCGGG + Intronic
1159647835 18:70940769-70940791 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1159778366 18:72630538-72630560 GTGTGTGTGTGTGGGGGGGAGGG - Intronic
1159789321 18:72758397-72758419 GTGTGTGTGTGTGTGGAGGAGGG + Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160731323 19:642878-642900 CTGTGTGTGTGTATGGCGGGGGG - Intronic
1161149671 19:2701429-2701451 TTGTGAGTGTGTGGGGTGGAAGG - Intronic
1161356657 19:3822955-3822977 CCGTCTGTCTGGAAGGTGGAAGG - Intronic
1161669675 19:5599178-5599200 CTGTGTGGGTTTAGAGTGGAGGG - Intronic
1161726029 19:5929575-5929597 CTGTGTGTGTGTGGGGCGGGAGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161887486 19:7007953-7007975 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1161984795 19:7647278-7647300 CTGGGTCTGTGTTAGGTGGGCGG + Intronic
1162943994 19:14031563-14031585 GTGTGTGTGTGTATGGTTGTTGG + Intergenic
1162951540 19:14074310-14074332 CTGTGTGTGTTTAAGGGGTGCGG + Intronic
1163064248 19:14781492-14781514 TTGTGTGTGTGTGAGGGGGACGG + Intergenic
1163174527 19:15555165-15555187 GTGTGTGTGTGTATGGAGTAAGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163754901 19:19100860-19100882 CTGTCTGAATGTAACGTGGAAGG - Intronic
1164906502 19:31972678-31972700 CTGGGTGTGTGTAAACTGGCAGG - Intergenic
1165003306 19:32783130-32783152 CTATTTTTGTGTAAGGTGTAAGG + Intronic
1165123382 19:33577820-33577842 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1165251959 19:34546097-34546119 CTGTGTGCTTTTATGGTGGATGG - Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165929015 19:39343986-39344008 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166437470 19:42780593-42780615 CTATGTGTATATCAGGTGGAGGG + Intronic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1166466363 19:43035258-43035280 CTATGTGTATATCAGGTGGAGGG + Intronic
1166486162 19:43214676-43214698 CTATGTGTATATCAGGTGGAAGG + Intronic
1166493277 19:43278318-43278340 CTATGTGTATATCAGGTGGAGGG + Intergenic
1167454772 19:49592270-49592292 TTGTGTGTGTGTAAGGGAGGGGG + Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1168153238 19:54460188-54460210 CTGTGTGTGTGGAAAGGGTAGGG + Intronic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1168415115 19:56162814-56162836 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1168522103 19:57060669-57060691 TTGTGTGTGTGTAAGAAAGACGG - Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925134261 2:1515377-1515399 CTGCGTCTGTGAAAGGTGGCAGG + Intronic
925140666 2:1547853-1547875 CTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140683 2:1547966-1547988 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140687 2:1548011-1548033 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140696 2:1548051-1548073 TGGTGTGTGTGTATGGTGGGTGG - Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925556198 2:5133739-5133761 ATGTGTGTGTGTAATGTGGGTGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925937578 2:8780528-8780550 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926533238 2:14078582-14078604 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
927060569 2:19415595-19415617 TTGTGTGTGTGTGAAGTGAATGG + Intergenic
927095100 2:19742393-19742415 CTGTGTGTGTGTGTGTTGGGGGG - Intergenic
927245423 2:20953555-20953577 ATGTATGTGTGTATGGTGTATGG + Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
927917854 2:26948066-26948088 GTGTGTGTGTGTGTGGTGGCAGG - Exonic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
928136555 2:28692307-28692329 GTGTGTGTGTCTAGGGTTGAGGG - Intergenic
928280401 2:29941316-29941338 GTGTGTGTGTGTGTGGTGGCAGG + Intergenic
928564264 2:32527633-32527655 CTGTGTGTGTGTGACTTTGAAGG + Intronic
929018739 2:37528727-37528749 GTGTGTGTATGTTAGGTTGAGGG + Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929073280 2:38055987-38056009 TTGTGTGTGTGTCAGGGTGAGGG - Intronic
929358990 2:41060640-41060662 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
929768110 2:44867680-44867702 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930019005 2:46989844-46989866 CTGTGTGTGTGTGTTTTGGAGGG + Intronic
930233332 2:48864907-48864929 TAGTGTGTGTGTGTGGTGGAGGG + Intergenic
930274599 2:49296865-49296887 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
930393460 2:50790128-50790150 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
930398294 2:50849851-50849873 GTGTGTGTGTGTACTGGGGAAGG - Intronic
930576080 2:53150501-53150523 GTGTGTGTGTGTAAGGGTGTGGG + Intergenic
931632897 2:64317219-64317241 CTGTGAGTGTGTATGGGGGGTGG - Intergenic
931694790 2:64863671-64863693 CCGTGTGTGTGGTAGGTTGATGG - Intergenic
931804585 2:65791578-65791600 AGGTGTGTGTGTAAGAGGGATGG + Intergenic
931894683 2:66716080-66716102 CTGTGTGTGTGTCTGGTGTTTGG + Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932156545 2:69423195-69423217 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
932529914 2:72518506-72518528 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
932918912 2:75887333-75887355 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
933615883 2:84482107-84482129 CTGTGTTTGTGTCAGGAGGTGGG - Intergenic
933638110 2:84729098-84729120 ATGTGTGTATGCAAGATGGATGG - Intronic
933796403 2:85923398-85923420 CAGTTTTTGTGTAGGGTGGATGG - Intergenic
934607200 2:95705276-95705298 GTGTGTGTGTGTGAGAAGGATGG - Intergenic
934610117 2:95729295-95729317 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
935116533 2:100142203-100142225 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
935521563 2:104112354-104112376 CTGTGTGTGTGTAATATTTAGGG + Intergenic
936062041 2:109301292-109301314 CTGTGTGTGTATGTGGTGGGGGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936572606 2:113628875-113628897 CGTTGTGTGTGTCGGGTGGAGGG + Intronic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
936857521 2:116978142-116978164 TTGTGTGTGTGTAAGGACAAGGG + Intergenic
937000867 2:118466486-118466508 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
937106143 2:119315171-119315193 ATGTGTGTGTGTATTATGGATGG - Intronic
937311872 2:120907760-120907782 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
937365699 2:121259660-121259682 TCATGTGTGTGTATGGTGGATGG - Intronic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
937890589 2:126935486-126935508 CTGGCTGTGTGTCTGGTGGATGG - Intergenic
938783204 2:134603807-134603829 GTGAGTGTATATAAGGTGGAAGG + Intronic
939231571 2:139432795-139432817 GTGTGTGTGTGTTAGGGGGTGGG - Intergenic
939312178 2:140495183-140495205 ATGTATGTATGTATGGTGGAGGG + Intronic
939629966 2:144518126-144518148 ATGTGTGTGAGTGAGGTGGGGGG - Intronic
939681835 2:145145607-145145629 GTGTGTGTGTGTATTGGGGATGG - Intergenic
939704259 2:145432457-145432479 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
939882893 2:147650199-147650221 CTGGGTGTGTGTCATGTGGCAGG - Intergenic
939996820 2:148927502-148927524 GTGTGTGTGTATAGGGGGGATGG + Intronic
940454323 2:153876192-153876214 GTGTGTGTGTGTAGTGTGGGGGG - Intronic
940865766 2:158816554-158816576 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
941129540 2:161629476-161629498 CTATGTATGTGTAAGGGGCAGGG - Intronic
941196819 2:162462720-162462742 CTGTGTATTTGCAAGGTGTATGG + Intronic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941334057 2:164218650-164218672 ATGTGTGTCTGTGTGGTGGAGGG + Intergenic
941404021 2:165066558-165066580 CTGTGTGTGTGTATGTGGGAGGG + Intergenic
941711084 2:168714106-168714128 CTGTGTCTTCGTATGGTGGAAGG + Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
941905632 2:170714957-170714979 GTGTGTGTGTGTATGTTGGGGGG + Intergenic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
942382543 2:175406930-175406952 GTGTGTGTGTGTTAAGGGGAAGG - Intergenic
942462561 2:176178340-176178362 CTGTGTGTGTCTAGGGTTGGGGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943230703 2:185247126-185247148 CAGTGTGTGTGTGTGCTGGAGGG + Intergenic
943355475 2:186849814-186849836 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
944014560 2:195019558-195019580 GTGTGTGTGTGTATGGAGGGGGG - Intergenic
944270432 2:197778795-197778817 GTGTGTGTGTGTATTTTGGAGGG - Intronic
944426906 2:199593042-199593064 GTGTGTGTGTGTATGCTGAAAGG - Intergenic
945026329 2:205623307-205623329 ATGTGTGTGTGTAATGGGGACGG - Intergenic
945128507 2:206540206-206540228 GTGTGTGTGTGTACAGTGAAGGG - Intronic
945948320 2:216015199-216015221 GCGTGTGTGTGTTGGGTGGAGGG + Intronic
946076025 2:217074379-217074401 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
946144412 2:217718129-217718151 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
946163736 2:217851347-217851369 CTGTGTGTGTGTATGTTGATTGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946673906 2:222136713-222136735 GTGTGTGTGTGTGTGATGGAGGG + Intergenic
946738262 2:222776086-222776108 GTGTGTGTGTGTATGGGGAAGGG - Intergenic
946739134 2:222784849-222784871 CTGTGTGTGTGTTAGAGGGAAGG - Intergenic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947108712 2:226695723-226695745 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
947336238 2:229087659-229087681 ATGTGTGTGTTTAAGGAGAAAGG - Intronic
947360406 2:229340276-229340298 TTGTGTGTGTGTCTGGTGGGAGG - Intergenic
947694107 2:232168679-232168701 CTATGTGTGGGTCAGGTGGTAGG - Intronic
947984305 2:234436040-234436062 CTGGGTGTGTGTCAGAGGGAGGG - Intergenic
948150545 2:235740948-235740970 TTGTGTGTGTGGCAGGTGGCAGG + Exonic
949029919 2:241789313-241789335 CTGTGTGTGTGTATAGTTGAAGG + Intronic
1168800335 20:640625-640647 GGGTGTGTGTGAAGGGTGGAGGG + Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168937736 20:1681416-1681438 CTATGTGTGTGTGTGGTGGGGGG + Intergenic
1168990686 20:2093685-2093707 GTGTCTGTGTGTATGGTGGAGGG - Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169244971 20:4017938-4017960 CTATGTATGTGTAGGGGGGAAGG + Intergenic
1169689799 20:8317520-8317542 GTGTGTGTGTGTCGGGGGGATGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1169926373 20:10788637-10788659 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1169986167 20:11447359-11447381 CTGTGTGTATGTCAGAGGGAGGG + Intergenic
1170145646 20:13170985-13171007 CTCTGTGTGTGAAAAGTGAATGG + Intergenic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170196918 20:13698560-13698582 CTGTGCTTGTGTATGGTAGATGG - Intergenic
1170322294 20:15113786-15113808 GTGTGTGTGTGTGTGCTGGAGGG + Intronic
1170731870 20:18983048-18983070 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1171098913 20:22363689-22363711 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1171168861 20:22997692-22997714 GTGTGTGTGTGTAAGGGGAGGGG + Intergenic
1171216312 20:23355043-23355065 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1171234550 20:23513578-23513600 ATGTGTGTGTGTGTGGTGGAGGG - Intergenic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1172362355 20:34322163-34322185 CTGTGTGTGGGTAAGTTAGCTGG + Intergenic
1172458148 20:35093618-35093640 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1172633698 20:36395060-36395082 GTGTGTGTGTGTTGGGTGAAGGG - Intronic
1172735134 20:37121076-37121098 CTGTGTGCTGGTAAGTTGGAGGG - Intronic
1172798154 20:37557621-37557643 GTGTGTGTGTGTAGGGTGGTAGG + Intergenic
1172946103 20:38690676-38690698 ATGTGTGTGTGTTGGGGGGAGGG + Intergenic
1173124408 20:40323508-40323530 CTGTGTGTGTGTAATTGGGTTGG - Intergenic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173635105 20:44548847-44548869 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
1173656735 20:44704701-44704723 CTCTATGTGTGTTAGGGGGAGGG - Intergenic
1173739911 20:45392808-45392830 ATGTGTGTGTGTTTGGTGGGGGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174568376 20:51483608-51483630 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1174683893 20:52435003-52435025 GTGTGTGTGTGTTATGTAGATGG - Intergenic
1174875517 20:54223035-54223057 CAGTTTGTGTGTAAGGAGTAGGG - Intronic
1174998562 20:55600357-55600379 GTGTGTGTGTTTCAGGTTGAGGG - Intergenic
1175197882 20:57257855-57257877 CTTTGTGTGTGTAAGTTGCCAGG + Intronic
1175314932 20:58040537-58040559 ATGTGTGTGTGTGGGGTGGGGGG - Intergenic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177107277 21:16975407-16975429 CTGTGTTTATGTTAGGGGGAAGG - Intergenic
1177241804 21:18467695-18467717 GTGTGTCTGTGTAAAGAGGAAGG + Intronic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1178476515 21:32942083-32942105 CCGTGTGTGTGCGAGATGGAGGG - Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1179094661 21:38301935-38301957 CTGTGTGTGTGCTTGGTGGGGGG - Exonic
1179393201 21:41012388-41012410 CTGTGTGTGTGTGAGCGTGAGGG - Intergenic
1179656500 21:42849085-42849107 GTGTGTGTGTGTGAGGTGCGTGG - Intronic
1179656505 21:42849190-42849212 CTGTGTGTGTGTGAGGTGCGCGG - Intronic
1179835057 21:44025870-44025892 GTGTGTGTGTGTCAGAGGGAAGG + Intronic
1180217022 21:46331050-46331072 GTATGTGTGTGTGAGGGGGAGGG + Intronic
1181750477 22:24985758-24985780 GTGTGTGTGTGTATGGTGAGGGG + Intronic
1182420326 22:30245735-30245757 GTGTGTGTGTGTTAGGAGGGAGG - Intronic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183718293 22:39547119-39547141 CTGAGTGTGTGTAGAGGGGAGGG + Intergenic
1183751448 22:39723311-39723333 GTGTGTGTGTGTCAGGTGGGTGG - Intergenic
1183866723 22:40710195-40710217 CTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1184089064 22:42283070-42283092 GTGTGTGTGTCTGAGGTGGGAGG - Intronic
1184203516 22:42985643-42985665 CTGTGTGTGTGTCTGTTGGAGGG - Intronic
1184207415 22:43014311-43014333 GTGTGTGTGTGTAGGGCGGGGGG - Intronic
1184297328 22:43533240-43533262 CTCTGAGTGTGTGTGGTGGATGG - Intronic
1184335920 22:43853191-43853213 CTGTGTGTGTGTAGTGTGTGTGG - Intronic
1184399657 22:44266544-44266566 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1184479945 22:44740498-44740520 GTGTGTGTGTGTAAGTGGGTAGG + Intronic
1184608616 22:45588498-45588520 CTGTGTGTGTATAAGAAGCAAGG - Intronic
1184727472 22:46355337-46355359 CTGTGTGTGTGTGTGCTGGTAGG + Intronic
1185013886 22:48332433-48332455 GTGTGTGTGTGTATGGTGTGTGG - Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185149046 22:49153917-49153939 CAGGGTGTGGGTAAGGTGGGAGG + Intergenic
1185351014 22:50338523-50338545 CGGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185351043 22:50338812-50338834 GTGTGTGTGTGTAGGGTGTGTGG + Intergenic
1185427584 22:50782004-50782026 CGTTGTGTGTGTCAGGTGGAGGG - Intronic
949523844 3:4883305-4883327 CTGTGTGTGTCTAGGGTGGTTGG + Intronic
949566278 3:5247676-5247698 GTGTGTGTGTGTACGGTGTGTGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950116971 3:10457214-10457236 GTGTGGGTGTGTAGGGTGTATGG + Intronic
950340642 3:12241061-12241083 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
950768936 3:15295081-15295103 CTGTGTGTGTGTGTGTTGGCGGG - Intronic
950854228 3:16090468-16090490 TAGTGTGTGTGGAAGGAGGAGGG + Intergenic
951118127 3:18889686-18889708 GTGTGTGTGTGTGTTGTGGAGGG + Intergenic
951363517 3:21752018-21752040 TTGTGTGTGTGTGTGGTGGGGGG - Intronic
951383624 3:22016925-22016947 GTGTGTGTGTGTCCGATGGATGG - Intronic
952127699 3:30321163-30321185 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
952266656 3:31793504-31793526 CTGTGTAGGTTTAAGGAGGATGG + Intronic
952643354 3:35625204-35625226 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
952645294 3:35650000-35650022 CTGTGTGTGTTTAAAGTGGATGG - Intronic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953341559 3:42138913-42138935 GTGTGTGTGTGTTTGGAGGAGGG + Intronic
953409792 3:42684307-42684329 GTGTGTGTGTGTCTGGTGGTGGG + Intergenic
953903414 3:46856308-46856330 ATGTGTGTGTGTAAGCCGGGAGG - Intergenic
954601068 3:51869905-51869927 TTGTGTGTGTGTAATCTGCAGGG - Intergenic
954881315 3:53837755-53837777 CAGAGTGTATGTAAGGTGGGAGG + Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955155036 3:56408461-56408483 GTGTGTGTGTGTTTGGGGGAGGG - Intronic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
955796119 3:62639044-62639066 GTGTGTGTTTGTGAGCTGGAGGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
956167718 3:66408948-66408970 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
956245314 3:67176094-67176116 TTGTGTGTGTGAGAGGTGGGGGG + Intergenic
956252039 3:67244579-67244601 GTGTGTGTGTGTATGGGGGTGGG - Intergenic
956321264 3:67999305-67999327 ATGTGTGTGTCTACGTTGGAGGG + Intergenic
957124912 3:76146716-76146738 GTGTGTGTGTGTCTGGTGGAGGG + Intronic
957124930 3:76146857-76146879 GTGAGTGTGTGTGTGGTGGAGGG - Intronic
957355026 3:79071693-79071715 GTGTGTGTGTGTATGGTACAAGG - Intronic
957556744 3:81771891-81771913 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
957738988 3:84238267-84238289 CTGTGTGTGTGTATGGGTGGGGG - Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958072356 3:88630333-88630355 CTGTGTGTGTGTGTGGGGGGGGG - Intergenic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959396595 3:105847385-105847407 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
959863899 3:111244253-111244275 GTGTGTGTGTGTAGGGTGGGAGG + Intronic
959941371 3:112085370-112085392 GTGTGTGTGTGTTGCGTGGAGGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960708626 3:120505526-120505548 TGGTGTGTGTGTGTGGTGGAAGG - Intergenic
960717114 3:120586768-120586790 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
960781445 3:121322669-121322691 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
961026809 3:123565462-123565484 CTGTGTCCTTGTATGGTGGAAGG - Intronic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961110318 3:124278014-124278036 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
961110381 3:124278475-124278497 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
961474442 3:127137948-127137970 CTGTGGGTGTGTGAGTGGGAGGG - Intergenic
961549789 3:127662453-127662475 CTCTCTGTGTGTAATGTTGATGG - Intronic
962060802 3:131925224-131925246 TTGTGTGTGTGTAGAGTGCAAGG - Intronic
962227459 3:133626336-133626358 ATGTGTGTTTGTATGTTGGAGGG + Intronic
962284798 3:134076660-134076682 CTGTGTGTGTGTAAATAGGAGGG + Intronic
962468879 3:135687437-135687459 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
962712987 3:138103074-138103096 CTGTGTGTATGTAGGGTGTGTGG - Intronic
962924451 3:139978692-139978714 GTGTGTGTGTGTTGTGTGGAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963343341 3:144064345-144064367 ATGTGTGTGTGTGTGGTGGGGGG + Intergenic
963602329 3:147389442-147389464 CAGTGTGTGTGTATTGGGGAGGG - Intronic
964289652 3:155163180-155163202 CTATGTGTGTGTATGGAGGGAGG - Intronic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
965885272 3:173437778-173437800 CTGTGTGTGTGTGTGTTGGTGGG - Intronic
966625068 3:182006878-182006900 ATGTGTGTGTGGTATGTGGAGGG + Intergenic
966656132 3:182360515-182360537 GTGTGTGTGTGTAGGGGGAAAGG + Intergenic
966923392 3:184629163-184629185 CTGCCTGGGTGTAAGGAGGAGGG - Intronic
967179439 3:186890738-186890760 ATGTGTGTGTGTAATGTTTAGGG + Intergenic
967272046 3:187740221-187740243 GTGTGTGTGTGTGAGGGGGTGGG - Intronic
967410240 3:189159854-189159876 GTGTGTGTGTGTGTGGTGGTGGG + Intronic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
967798768 3:193630204-193630226 CTGTGTGTGTTTATGCAGGATGG - Intronic
967984025 3:195082188-195082210 CTGTGTGTGTCAAGGGTGGCGGG + Intronic
968223147 3:196953410-196953432 CAGGGTGTGTGAAAGTTGGAGGG - Intronic
968810908 4:2799317-2799339 CCCTGGGTGTGTAAAGTGGAGGG + Intronic
968960703 4:3741952-3741974 CTGTGTGTGTGTGTGGTTGCAGG - Intergenic
969061035 4:4435067-4435089 ATGTGTGTGTGTGATGGGGAGGG + Intronic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
969115632 4:4869158-4869180 CTTTGTGTGTGTGTGGTGGGGGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969426695 4:7128574-7128596 GTGTGTGTGTGTCAGGGGGTGGG + Intergenic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969936746 4:10689610-10689632 CTATGTTTGTGTAAGTTGCAAGG - Intergenic
970197225 4:13563290-13563312 GTGTGTGTGTGTTTGGGGGAGGG + Intergenic
970354128 4:15235569-15235591 GTGTGTGTGTTTAGGGTCGAAGG - Intergenic
970416254 4:15860222-15860244 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
970714310 4:18904153-18904175 TTGTGTGTGTGTTAGGTGGGGGG - Intergenic
970930154 4:21501704-21501726 GTGTGTGTGTGTGCGTTGGAAGG + Intronic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971864198 4:32147686-32147708 CTGTGTGTGCGTAAGTTTTATGG + Intergenic
972278562 4:37581970-37581992 CTGTGTGTGGGTAGGCTGGGGGG + Intronic
972337992 4:38125492-38125514 TTGTGTGTGTGTATGTTGAATGG + Intronic
972675150 4:41253038-41253060 TTGTGTGTGTGTTTGGGGGATGG - Intergenic
972688014 4:41369681-41369703 TTGTGTGTGTGTGTGGTGGGGGG + Intronic
973188016 4:47353921-47353943 GTGTGTGTGTGTATGTTGGCAGG - Intronic
973207071 4:47572665-47572687 GTGTGTGTGTGTGTGTTGGATGG + Intronic
973967764 4:56181473-56181495 TTGTGTGTGTGCTGGGTGGAGGG - Intronic
974884699 4:67804244-67804266 GTGTGTGTGTGTTTAGTGGATGG + Intergenic
974967455 4:68779161-68779183 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
975170372 4:71225675-71225697 CTGTGTGTGTCAGAGGTGGGTGG + Intronic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
975597657 4:76065546-76065568 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
975773341 4:77755154-77755176 CTGTGTGTGTGTCATTTGTAAGG - Intronic
975799501 4:78045119-78045141 GTGTGTGTGTGTGTGGGGGAGGG + Intergenic
975986345 4:80203739-80203761 CTGTGTGTGTGTGTGGGGGGGGG - Exonic
976393546 4:84531389-84531411 TTGTGTGTGTGTATGGTTTAAGG + Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976686225 4:87818739-87818761 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
977284540 4:95086001-95086023 GTGTGTGTGTGTAAAAAGGAGGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977890575 4:102306637-102306659 CTGTGTGTGTGCATTGTGGGTGG + Intronic
977924852 4:102688376-102688398 GTGTGTGTGTGTAAGGGGGGAGG - Intronic
978384561 4:108167341-108167363 GTGTGTGTGTGTAGGATGGGAGG - Intronic
978435434 4:108679058-108679080 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
978645782 4:110929686-110929708 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
979695398 4:123607456-123607478 ATGTGGCTCTGTAAGGTGGAAGG + Intergenic
980097436 4:128505983-128506005 CTGTGTGTGTGTATGATTGGGGG + Intergenic
980104026 4:128570156-128570178 GTGTGTGTGTGTGTGGTTGAGGG - Intergenic
980753750 4:137128806-137128828 ATGTGTGTGGGTAAAGTGAAGGG - Intergenic
980986093 4:139695878-139695900 CTGTGTGTGTGTGGGGCGGGGGG - Intronic
982377157 4:154705411-154705433 TTGTATGTGTGTAGGGTTGAGGG + Intronic
982705118 4:158700549-158700571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
982929136 4:161379477-161379499 CAGTGTGTGTGTATGGGGGAGGG + Intergenic
983379676 4:166976106-166976128 GTGTGTGTGTGTGTGGTGGGTGG - Intronic
983571696 4:169215808-169215830 CTGTGTGTGTGAAGCGTGAAGGG + Intronic
983684863 4:170396631-170396653 GTCTGTGTGTGTAAGAGGGAAGG - Intergenic
984117828 4:175704355-175704377 TTGTGTGTGTGTGGGGTGGGGGG - Intronic
984413991 4:179433729-179433751 GTGTGTGTGTGTATGTTGGAGGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984521089 4:180801707-180801729 ATGTGTGTGTGTAGGGTGGGGGG + Intergenic
984564320 4:181309494-181309516 GTGTGTGTGTGTGAGATGGTGGG + Intergenic
984848442 4:184129281-184129303 GTGTGTGTGTGTATGTTGGGGGG - Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985253769 4:188049203-188049225 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985498091 5:221886-221908 CTCTGTGTGTGTGTGGTGGGGGG + Intronic
985547207 5:515746-515768 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547214 5:515774-515796 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547221 5:515800-515822 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547228 5:515828-515850 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547235 5:515854-515876 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547242 5:515882-515904 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547249 5:515910-515932 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547256 5:515936-515958 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547263 5:515966-515988 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547270 5:515992-516014 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547278 5:516019-516041 GTGTGTGTGTGTGAGGGGGCAGG - Intronic
985547285 5:516045-516067 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
986437523 5:7748513-7748535 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986677005 5:10194532-10194554 GTGTGTGTGTGTGAGGGGGTGGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987095555 5:14546262-14546284 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
987217420 5:15751578-15751600 CTATTTGTGTGTAAGTTGTATGG - Intronic
987337849 5:16912791-16912813 GTGTGTGTGTGCAGGGTGGTAGG - Intronic
987544347 5:19293199-19293221 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
988097158 5:26630687-26630709 GTGTGTATGTGTATGGAGGAAGG + Intergenic
988317953 5:29655926-29655948 GTGTGTGTGTGTGTAGTGGAGGG + Intergenic
988391016 5:30631112-30631134 GTGTGTGTGTGTGAACTGGATGG - Intergenic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
988659745 5:33252440-33252462 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
988700213 5:33666199-33666221 CTGTGTATGTTAACGGTGGAGGG - Intronic
988867931 5:35355579-35355601 GTGTGTGTGTGTAGTGGGGAGGG + Intergenic
989131029 5:38106563-38106585 GTGTGTGTGTGTTTGGTGGTGGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
990350235 5:54908763-54908785 CTGAGTGTGTGTTTGGTGGGGGG - Intergenic
990442908 5:55864607-55864629 CTGTGTGTGTGTGGTGTGTATGG - Intronic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991658800 5:68930383-68930405 CCTTGTGGGTGTAAGGCGGATGG - Intergenic
992147772 5:73869206-73869228 GAGTGTGTGTGTGGGGTGGAGGG + Intronic
992193967 5:74321607-74321629 TTTTGTGTTTGTAAGGTGGTGGG - Intergenic
992204311 5:74415412-74415434 CTGTGTGTGTGTAAAGGGAGGGG - Intergenic
992216345 5:74528304-74528326 GTGTGTGTATGTTAGCTGGAGGG - Intergenic
992299522 5:75364007-75364029 CTGTGTGTGTGTGTGTTGGAAGG + Intergenic
992996881 5:82343142-82343164 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
993045279 5:82859327-82859349 TTGTGTGTGTGTATGTTGGGAGG - Intergenic
993754757 5:91714726-91714748 CTGTGTGTGTGTAACTTGTGTGG - Intergenic
993924241 5:93845749-93845771 CTGTGTCTGTGTGTGTTGGAGGG + Intronic
994067586 5:95560657-95560679 GTGTGTTTGTGTATGGTGCAAGG - Intronic
994114269 5:96044372-96044394 CTGTGTCTTTATATGGTGGAAGG - Intergenic
994205473 5:97030658-97030680 GTGTGTGTGTGTAGTGTGGGGGG + Exonic
994272127 5:97790533-97790555 GTGTGTGTGTGTGTGCTGGACGG - Intergenic
994376711 5:99023114-99023136 TTGTGTGTGTGTGTGGAGGAAGG + Intergenic
994382173 5:99084572-99084594 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
994716485 5:103327871-103327893 ATGTGTGTGTGAATGGTGGCTGG + Intergenic
995131027 5:108630670-108630692 GGGTGTGTGCGTAAGGTGGGTGG + Intergenic
995188804 5:109298957-109298979 ATGTGTGTGAGTTAGGTGGGAGG + Intergenic
995226043 5:109702351-109702373 GTCTGTGTGTGTAGGGAGGATGG + Intronic
995461008 5:112402995-112403017 GTGTGTGTGTGTGAGCTAGAGGG - Intronic
995568948 5:113459167-113459189 GTGTGTGTGTGTGAAGTGGGTGG + Intronic
995754822 5:115491620-115491642 GTGTGTGTGTGTTGGGTGGCGGG + Intergenic
996210072 5:120798070-120798092 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
996283181 5:121757068-121757090 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
996757122 5:126946796-126946818 GTCTGTGTGTGTGTGGTGGAGGG + Intronic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996957577 5:129202573-129202595 CAGTGTGTGTCTGTGGTGGAAGG + Intergenic
996978044 5:129459219-129459241 GTGTGTGTGTGTAATGGGGTGGG + Intergenic
997509703 5:134445649-134445671 GTGTGTGTGTGTGATGGGGATGG + Intergenic
997652590 5:135533618-135533640 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
997734483 5:136203307-136203329 CTGTGTGTGTGTTGAGTGGGGGG - Intergenic
998232399 5:140369188-140369210 TGGTGTGTGCCTAAGGTGGAAGG + Intronic
998390454 5:141783990-141784012 CTGTGTGTGTGTCTGGGGGAAGG - Intergenic
998423861 5:142011275-142011297 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
998676895 5:144419479-144419501 CTGTGTATGTTTAATGTGAATGG + Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998903619 5:146880211-146880233 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
999178921 5:149654885-149654907 GTGTGTGTGTGTGAGGTGTGTGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
999652216 5:153778644-153778666 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
999732266 5:154483483-154483505 CTGTGTGTGTGTACGAGGGGGGG + Intergenic
999900584 5:156082247-156082269 GTGTGTGTGTGTAGGCTGGTGGG + Intronic
1000107353 5:158072887-158072909 CTGTGTGTGGGTGTGGTGGGGGG + Intergenic
1000227858 5:159285189-159285211 GTGTGTGTGTGTGTGGTGGGAGG - Exonic
1000799235 5:165703870-165703892 GTGTATGTGTGTTGGGTGGAAGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001010155 5:168090211-168090233 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1001229603 5:169974834-169974856 ATGTGTGTGTGTCGGGGGGAGGG - Intronic
1001322376 5:170693248-170693270 ATGTGTGTGTGTCGGGGGGATGG - Intronic
1001413742 5:171528748-171528770 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
1001790636 5:174454745-174454767 CTGTGTGTGTTTATGGAGCAGGG - Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1001842801 5:174893506-174893528 GTGTGTGTATGTGTGGTGGAGGG + Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1002095917 5:176830976-176830998 GTGTGTGTGTGTGAGATGGGAGG + Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002375144 5:178783396-178783418 CTGTGTGTGTGTGTGGTGTGTGG - Intergenic
1002712932 5:181205747-181205769 GTGTGTGTGTGTGCGGTGGGGGG - Intergenic
1002999324 6:2316811-2316833 CTGTGTGTGTGTGTGGAGGGTGG + Intergenic
1003005351 6:2376111-2376133 CTGTGTGTGTGTTGGGTGTAGGG - Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003672773 6:8174787-8174809 CTGTGGGAGTGAAAGGTGGTGGG + Intergenic
1004243838 6:13953372-13953394 GGGTGTGTGTGTATGGTGGGGGG + Intronic
1004244220 6:13956915-13956937 GGGTGTGTGTGTATGGTGGGGGG - Intronic
1004271795 6:14202210-14202232 CTCTGCGTGTGTGGGGTGGAGGG - Intergenic
1004932049 6:20472019-20472041 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1005154275 6:22785766-22785788 CTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005188198 6:23186549-23186571 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005396365 6:25386246-25386268 TTGTGTGTGTGTGGGGTGGGTGG + Intronic
1005692129 6:28317083-28317105 GTGTGTGTGTGTAAGGGGCTGGG - Intergenic
1005730814 6:28695025-28695047 GTGTGTGTGTGTGTGGTGGCGGG - Intergenic
1005988948 6:30891561-30891583 GTGTGTGTGTGTAGGGGGGCTGG + Intronic
1006179599 6:32146879-32146901 CTGTGTGTGTGTCGGGGGAAGGG + Intergenic
1006450632 6:34103930-34103952 CTGTGTGTGAGAGAGGTGCATGG - Intronic
1006804176 6:36777759-36777781 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007062079 6:38950214-38950236 GTGTGTGTTTGTATGGTGGATGG + Intronic
1007073375 6:39051881-39051903 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1007315657 6:40986655-40986677 GTGTGTGTGTGTCAGGGTGAAGG + Intergenic
1007481429 6:42152889-42152911 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1007518724 6:42434661-42434683 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1007595990 6:43051584-43051606 CTTTGGGGGTGTAAGGTGGGGGG - Intronic
1007698021 6:43746235-43746257 GTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1007769258 6:44180090-44180112 CTGTGTGGCTCAAAGGTGGAGGG - Exonic
1007934629 6:45721919-45721941 CTGTTTGTGTGTCAGGTGCCAGG - Intergenic
1008023512 6:46607454-46607476 GTGTGTGTGTGTAGGGGGAAGGG - Intronic
1008258150 6:49330260-49330282 GAGTGTGTTTGGAAGGTGGACGG - Intergenic
1008396722 6:51017296-51017318 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1008640506 6:53457660-53457682 GTGTGTGTGTGTTTGGTGGGGGG + Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009469167 6:64010376-64010398 CTGTGTGTGTGTTTGGTTGGGGG + Intronic
1009711341 6:67325502-67325524 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1009923007 6:70086271-70086293 GTGTGTGTGTGTCAGGGGGGTGG - Intronic
1010688764 6:78883011-78883033 CTTTGAGAGTCTAAGGTGGAAGG + Intronic
1010925860 6:81745168-81745190 GTGTGTGTGTGTTGGGTGCAAGG - Intronic
1010930931 6:81802248-81802270 GTGTGTGTGTGTTTGGTGTATGG + Intergenic
1011049788 6:83132358-83132380 GTGTGTGTGTGTGTGGCGGAGGG - Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1012278909 6:97305573-97305595 GTGTGTGTGTGTAAGGGGGGTGG - Intergenic
1012547473 6:100435985-100436007 GTGTGTGTGTGTGATGTGTATGG - Intronic
1012612442 6:101232214-101232236 GTGTGTGTGTGCATGGTGGAGGG - Intergenic
1012790104 6:103682414-103682436 GTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1012997397 6:105986901-105986923 GTGTGTGTGTGTGTAGTGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013339624 6:109200860-109200882 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1013734055 6:113205347-113205369 GTGTGTGTGTGTGTGGTGAAGGG + Intergenic
1013929115 6:115508977-115508999 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1014107339 6:117582263-117582285 GTGTGTGTGTGTAGGGGGGGAGG - Intronic
1014740949 6:125147205-125147227 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1014785422 6:125613171-125613193 GTGTGTGTGTGTAACGTGAACGG - Intergenic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015413897 6:132926742-132926764 GTGTGTGTGTGTGAGCGGGAGGG - Intergenic
1015796594 6:137018538-137018560 GTGTGTGTGTGTTAGGGGTAGGG + Intronic
1015875615 6:137819038-137819060 CTGGGTGTGTGTTAGGGGAAAGG - Intergenic
1016037048 6:139394164-139394186 GTGTGTGTGTGTATGGTGTGGGG - Intergenic
1016037052 6:139394188-139394210 GTGTGTGTGTGTATGGTGTGGGG - Intergenic
1016209251 6:141507909-141507931 GTGTGTGTGTGTGAGGTGGGGGG + Intergenic
1016403327 6:143704109-143704131 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1016516072 6:144894224-144894246 ATGTGTGTGTGTAAGGGGGGAGG + Intergenic
1016553619 6:145310590-145310612 ATGTGTGTGTGTACGGGGGGTGG - Intergenic
1016916519 6:149248950-149248972 GTGTGTATGTGTATGGGGGATGG - Intronic
1017458073 6:154621104-154621126 GTGTGTGTGTTTGTGGTGGAAGG - Intergenic
1017488097 6:154921295-154921317 CTGGGTATGTGTGAGGGGGAGGG - Intronic
1018150655 6:160934366-160934388 CTGTGTGTGTACATGGTGTATGG - Intergenic
1018163692 6:161073768-161073790 TTGTGTGTGTGTATTGCGGAGGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018588036 6:165384658-165384680 GTGTGTGTGTGTATGGGGGGGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019869617 7:3747707-3747729 GTGTGTGTGTGTATGGTGAGGGG + Intronic
1020370730 7:7429460-7429482 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1020418151 7:7969239-7969261 GTGCGAGTGTGTAAGGGGGAGGG - Exonic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1021157995 7:17235793-17235815 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1021303908 7:19007793-19007815 GTATGTGTGTGTAAGCTGCAAGG + Intergenic
1021434085 7:20594676-20594698 GTGTGTGTGTGTATGTTGGAGGG - Intergenic
1021568299 7:22036662-22036684 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1021910787 7:25384408-25384430 GTGTGTGTGTGTGTAGTGGAAGG + Intergenic
1021925907 7:25533469-25533491 CTGTGTCCTTGTATGGTGGAAGG + Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022244536 7:28545818-28545840 CTGTGTGTGTGTGAAGTGAATGG + Intronic
1022248068 7:28580422-28580444 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1022812732 7:33885561-33885583 CTCTGTGTGTGTTTGGTGGGGGG - Intergenic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1023039723 7:36161526-36161548 CCGTGTGTGTGCATGGGGGAGGG - Intronic
1023173259 7:37410534-37410556 CTGTGTGTGTGTTAAGGGGTGGG - Intronic
1023517279 7:41014265-41014287 CTGTGTGTGTCTGTGGTGAATGG + Intergenic
1024178355 7:46863336-46863358 CTCTGTGTGTGTGAAGTGGTGGG - Intergenic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025030611 7:55553746-55553768 GTGTGTGTGTGTAGAGTGCAGGG - Intronic
1025034501 7:55585234-55585256 GTGTGTGTGTGTATGGAGGCTGG + Intergenic
1025262245 7:57426861-57426883 GTGTGTGTGTGTAGGGGGGGGGG + Intergenic
1026053815 7:66967923-66967945 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1026188801 7:68105631-68105653 CTGTGTGTGTGAGAAGGGGAAGG + Intergenic
1026647936 7:72188911-72188933 CTTTGTGTGTGTGCGGTGTAGGG - Intronic
1026805613 7:73428497-73428519 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1027209991 7:76138462-76138484 CTATGTTTGTATAAGGTGAATGG + Intergenic
1027233438 7:76284662-76284684 CTGAGTGGGTGCCAGGTGGAAGG - Intronic
1027412422 7:77935122-77935144 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1027551269 7:79599310-79599332 CTGTATGTGTGTCAGGGGGAGGG + Intergenic
1027640780 7:80731241-80731263 CTGTGAGTTTGTAAGGTCCACGG + Intergenic
1027675882 7:81157941-81157963 ATGTGTATGTGTATGTTGGAGGG + Intergenic
1027828085 7:83142035-83142057 GTGTGTGTGTGTCGGGGGGAGGG - Intronic
1028036322 7:85988544-85988566 GAGTGTGTTTGTTAGGTGGAAGG - Intergenic
1028487926 7:91380283-91380305 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1028492518 7:91428011-91428033 CTTTGTTTGTGTAAGGTGGTGGG - Intergenic
1028549442 7:92042306-92042328 CTGCATGTGTGTAAGGTAGGTGG + Intronic
1029335990 7:99899733-99899755 CTGTGTCTGTGTATGGTGGGTGG + Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030071567 7:105702516-105702538 CTGTGTGTGTGTAAGGGGCTGGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030369288 7:108678820-108678842 GTGTGTGTGTGTGATGTAGAAGG - Intergenic
1030607430 7:111652574-111652596 GTGTGTGTGTGTTAGGATGAAGG - Intergenic
1030787260 7:113677497-113677519 GTGTGTGTGTGTGAGATGGATGG - Intergenic
1031052771 7:116961580-116961602 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1031132732 7:117851380-117851402 TTGTGTGTGTGTGAGGGGGTTGG - Intronic
1031134485 7:117871835-117871857 GTGTGTGTGTGTGAAGGGGAAGG - Intronic
1031253629 7:119419410-119419432 CTCTGTGTGTGTGTGGTGGGAGG - Intergenic
1031472894 7:122188984-122189006 GTGTGTGTGTGTAATCTTGAGGG - Intergenic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1032158732 7:129493214-129493236 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1032173796 7:129607837-129607859 CTTTGTGTGTGTTTGGTGGTGGG + Intergenic
1032349319 7:131145627-131145649 ATGTAGGTGTGTAAGGGGGATGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033013036 7:137642960-137642982 GTGTGTGTGTGTATGGGGGATGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1033611804 7:142970468-142970490 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
1033618559 7:143041023-143041045 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1033771750 7:144560013-144560035 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
1034858968 7:154580190-154580212 GTGTGTGTGTGTAAGGGGGAGGG - Intronic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1034862543 7:154611865-154611887 GTGTGTGTGTGTGTGGTGTATGG + Intronic
1034924384 7:155109649-155109671 CTGTGTGTGAGGAATGTGCAGGG + Intergenic
1035353113 7:158260642-158260664 GTGTGGGTGTGTTATGTGGACGG - Intronic
1035380299 7:158434925-158434947 TTGTGTGTGTGTATGGTATAAGG - Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035572414 8:681565-681587 CTCTGTCTATGTTAGGTGGAGGG - Intronic
1035977553 8:4329839-4329861 GTGTGTGTGTGTAAGCAGGGTGG - Intronic
1036175877 8:6538263-6538285 ATGTGTGTGTGTAAGACAGATGG - Intronic
1036518138 8:9465107-9465129 ATGTGTGTGTGTTTGGTGTAAGG - Intergenic
1036652369 8:10653453-10653475 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1036690992 8:10944707-10944729 CAGGGTGTGTGCAGGGTGGAGGG - Intronic
1036963743 8:13273718-13273740 GTGTGTGTGTGTAAGGGGGAAGG + Intronic
1037338879 8:17820681-17820703 CTGTGTGTGTGTAGAGGGGGAGG - Intergenic
1039100413 8:33935429-33935451 CTGTGTATGTGTATGGAGTAAGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039364814 8:36918591-36918613 ATGTGTGTGTGTGTGGTGGGGGG - Intronic
1039475227 8:37836032-37836054 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1039557741 8:38488726-38488748 GTGTGTGTGTGTGTTGTGGAGGG - Intergenic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1040792707 8:51251843-51251865 CTGTGTGTCTGTGTGGTGGGGGG + Intergenic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1042232009 8:66567541-66567563 GTGTGTGTGTGTAGTGTGGGAGG + Intronic
1042401605 8:68355237-68355259 TTGTGTGTGTGTTTGGTGGTGGG - Intronic
1042448837 8:68921273-68921295 GTATGTGTGTGTATGGTGGGGGG + Intergenic
1042743361 8:72075896-72075918 GTGTGTGTGTGTTGGGTGGAGGG + Intronic
1043054599 8:75421945-75421967 GTGTGTGCGCGTCAGGTGGAGGG + Intronic
1043151267 8:76719176-76719198 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1043444022 8:80301546-80301568 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1043681220 8:83027092-83027114 GTGTATGTGTGAAAGGTGGATGG - Intergenic
1044071390 8:87764532-87764554 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1044281410 8:90361247-90361269 GTGTGTGTGTGTATGGTGGGGGG + Intergenic
1044501829 8:92966387-92966409 GTGTGTGTGTGTGAGATGGGAGG - Intronic
1044509648 8:93059768-93059790 GTATGTGTGTGTAAGTTGGGGGG - Intergenic
1044646494 8:94449193-94449215 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1044776829 8:95698751-95698773 TTGTGTGTGTGTTTGGGGGAGGG - Intergenic
1044796730 8:95908542-95908564 ACGTGTGTGTGTTAGGTGTAGGG - Intergenic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045420399 8:102008907-102008929 GTGTGTGTGTGTAGGGGGGCGGG - Intronic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045682016 8:104671753-104671775 CTTTGGGTTTCTAAGGTGGAGGG + Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1045739141 8:105334146-105334168 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1045748979 8:105459307-105459329 CTGGGTGTGTGTGTGGTGGCAGG + Intronic
1045838889 8:106556507-106556529 TTGTGTGTGTGTGAGCTGGGTGG + Intronic
1046297119 8:112234145-112234167 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
1046328166 8:112677247-112677269 CTGTGTGTGTGTAAGCATGGGGG + Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1046808829 8:118510207-118510229 ATGTGTGTGTGTGTGGTGGGGGG - Intronic
1046827460 8:118706952-118706974 CAGTGTGTGTGTGTGGTGTAGGG + Intergenic
1046890357 8:119415853-119415875 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1047141670 8:122147797-122147819 GTGTGTGTGTGTGTGGAGGATGG - Intergenic
1047739952 8:127798378-127798400 CTGTTTGTGCCTAAGGTGCACGG - Intergenic
1048056991 8:130876701-130876723 TTGTGTGTGTGTAGGGGGGCAGG + Intronic
1048292975 8:133194467-133194489 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1048301949 8:133258218-133258240 GTGTGTGTGTGTGTGGTGCATGG - Intronic
1048389616 8:133949414-133949436 GTGTGTGTGTGTAATGTTTAGGG - Intergenic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048823638 8:138402017-138402039 GTGTGTGTGTGTGAGGAGGGTGG + Intronic
1049029936 8:140027279-140027301 CTGTGTATATGTTAGGTGGTTGG - Intronic
1049039609 8:140102466-140102488 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1049172778 8:141172241-141172263 CTGTGGGTGTGCACGGTGGTGGG + Intronic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049570205 8:143366502-143366524 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049908668 9:244269-244291 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1050534732 9:6622139-6622161 GTCTGTGTGTGTGTGGTGGAGGG - Intronic
1050800177 9:9601139-9601161 GTGTGTGTGTGTATGGGGGGGGG + Intronic
1050860129 9:10418436-10418458 GTGTGTGTGTGTAGAGGGGAAGG - Intronic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051205239 9:14681747-14681769 GTGTGTGTGTGTAAGTGGGTGGG + Intronic
1051332714 9:16039848-16039870 GTGTGTGTGTGTAATGGGGTGGG + Intronic
1052042173 9:23751368-23751390 CAGTTTGTGTGTATGGGGGAGGG - Intronic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052328877 9:27246952-27246974 TTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1052756345 9:32546343-32546365 CTGTGTGTGTGGTAGAGGGAAGG + Intronic
1053202860 9:36164601-36164623 GTGTGTGTGTGTATGGGGGTGGG - Intergenic
1053558412 9:39162507-39162529 CTGTGTGTCTTTATGGTAGAAGG - Intronic
1053904872 9:42831414-42831436 TTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1054138702 9:61456435-61456457 CTGTGTGTCTTTATGGTAGAAGG + Intergenic
1054729912 9:68691055-68691077 GTGTGTGTGTGTTAGAGGGAAGG + Intergenic
1055291786 9:74789088-74789110 CTTTCTGTGTTTAAGATGGAGGG - Intronic
1055361160 9:75491858-75491880 GTTTGTGTCTGTCAGGTGGATGG - Intergenic
1056084374 9:83130763-83130785 CTGTGTGTTTGTAAGCTGTCTGG - Intergenic
1056121222 9:83491259-83491281 CTATGGGTGTGTAAGAAGGAAGG + Intronic
1056232040 9:84556954-84556976 GTGTGTGTGTGTGTGTTGGAAGG + Intergenic
1056573653 9:87837905-87837927 CTGTGTGTTTGTGTGGTGGGAGG - Intergenic
1056575754 9:87855306-87855328 ATGTGTGTGTGTGTGTTGGAGGG - Intergenic
1056620085 9:88205319-88205341 TTTTGTGTGTGTATGGTGTAGGG - Intergenic
1056781073 9:89551539-89551561 CTGTGTGTGCGTGGGGTGGGGGG - Intergenic
1057074884 9:92133417-92133439 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1057573473 9:96220984-96221006 GTGTGTGTGTGTTAGGGGGGCGG - Intergenic
1057574635 9:96232450-96232472 ATGTGTGTGTGTAAGGGGCAGGG - Intergenic
1059090540 9:111352932-111352954 GTGTGTGTGTGTAAAATGAAGGG + Intergenic
1059161293 9:112037744-112037766 ATGTGTGTGTGTGTGGTGGGTGG - Intergenic
1059280735 9:113131465-113131487 GTGTGTGTGTTTAAGGTGTGGGG + Intergenic
1059287840 9:113191711-113191733 TTGTGTGTGTGAAAGGAGGGAGG + Intronic
1059541633 9:115136265-115136287 GTGTGTGTGTGTATGTTGGGGGG + Intergenic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1059815959 9:117915398-117915420 ATGTGTGTGTGGTAGGTAGAGGG + Intergenic
1059911439 9:119048731-119048753 CTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1059967513 9:119629938-119629960 GTGTATGTGTGTATGGTGGGGGG - Intergenic
1059973242 9:119689141-119689163 GTGTGTGTGTGTAAGATACAAGG - Intergenic
1060231003 9:121825219-121825241 GTGTGTGTGTGTGAGATGGTCGG + Intronic
1060508793 9:124217242-124217264 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1060584838 9:124779531-124779553 TTGTGTGTGTGTGTGGTGGGGGG + Intronic
1060649757 9:125315253-125315275 TTGTGTGTGTGTGTGGAGGATGG - Intronic
1060982437 9:127801464-127801486 GTGTGTGTGTGTATGGGGGAAGG + Intronic
1061005182 9:127924863-127924885 GTGTGTGTGTGTAGAGGGGAGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1061884107 9:133583016-133583038 CTGTGTGTATGTCACCTGGAGGG + Intronic
1062288505 9:135784392-135784414 CTGTGTGTGTGTATGCATGAGGG + Intronic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1203655961 Un_KI270752v1:25056-25078 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1185518454 X:718524-718546 GTGCATGTGTGTGAGGTGGAGGG + Intergenic
1185527367 X:790261-790283 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1185650202 X:1642095-1642117 GTGTGTGTGTGTGATGGGGACGG + Intronic
1185650277 X:1642507-1642529 CTGTGTGTGTGTGATGGGGACGG + Intronic
1185709722 X:2293805-2293827 CAGTGTGTGTGTGTGGTGGGGGG + Intronic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186613995 X:11167337-11167359 GTGTGTGTGTGTGTGATGGAGGG + Intronic
1186716484 X:12257367-12257389 TTGTGTGTGTGTATGCTAGAAGG - Intronic
1186756968 X:12681686-12681708 GTGTGTGTGTGTATCCTGGATGG - Intronic
1187203309 X:17157025-17157047 GTGTGTATGTGTATGGAGGATGG + Intergenic
1187648166 X:21373151-21373173 GTGTGTGTGTGTGGGGGGGAAGG + Intergenic
1188628553 X:32320002-32320024 AAGTATGTGTGTGAGGTGGAGGG - Intronic
1188879435 X:35473514-35473536 TTACGTGTGTGTATGGTGGATGG + Intergenic
1188985925 X:36768284-36768306 GTGTGTGTGTGTATTGGGGAGGG - Intergenic
1189185217 X:39049001-39049023 GTGTGTGTGTGTGTGGTAGAAGG - Intergenic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189582301 X:42419755-42419777 ATGTGTGTGTGTGTGGTGGTGGG + Intergenic
1189646686 X:43140395-43140417 GTGTGTGTCTTTAGGGTGGAAGG - Intergenic
1189756775 X:44280020-44280042 GTGTGTGTGTGTATGGGGGATGG - Intronic
1189910396 X:45805157-45805179 TTGTGTGTGTGTGAGGAGGGAGG + Intergenic
1190157434 X:48005306-48005328 GTGTGTGTGTACAAGGTGGTTGG - Intronic
1190173204 X:48128191-48128213 GTGTGTGTGTACAAGGTGGTTGG - Intergenic
1190930514 X:54945732-54945754 GTGTGTGTGTGTGAGGTGTGTGG + Intronic
1191671402 X:63751866-63751888 ATGTGTGTGTGTAGGGTGTGTGG - Intronic
1192271556 X:69584909-69584931 GTGTGTGTGTGTATAGTTGATGG - Intergenic
1192639748 X:72850449-72850471 GTGTGTGTGTGTATGGGGGGAGG - Intergenic
1192641963 X:72870356-72870378 GTGTGTGTGTGTATGGGGGGAGG + Intergenic
1193274933 X:79574679-79574701 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193943550 X:87705815-87705837 TTATGTGTGTGAAAGGTAGAGGG - Intergenic
1194424518 X:93720034-93720056 GTGTGTGTGTGTGTGGTGGGTGG + Intergenic
1194551364 X:95304744-95304766 CTGTGTGTGTGTTTGGGGGGGGG - Intergenic
1194988688 X:100520775-100520797 TTGTGTGTGTGTGTTGTGGAGGG + Intergenic
1195150335 X:102061438-102061460 TTGTGTGTGTGTATGGGGCAGGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1195477513 X:105303636-105303658 TTGTGTGTGGGCAAGCTGGAAGG - Intronic
1195600019 X:106735900-106735922 GTGTGTGTGTGTTGGGGGGAGGG - Intronic
1195606080 X:106807203-106807225 GTGTGTGTGTGTATGGGGGGGGG - Intronic
1196031216 X:111096859-111096881 GTGTGTGTGTGTAAGGGGCGGGG - Intronic
1196050514 X:111298966-111298988 GTGTGTGTGTGTAAGAAGGAGGG + Exonic
1196189951 X:112783707-112783729 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196856611 X:119990873-119990895 GTGTGTGTGTGTGTGGCGGAAGG - Intergenic
1196857825 X:120000274-120000296 GTGTGTGTGTGTGTGGCGGACGG + Intergenic
1197503647 X:127274492-127274514 GTGTGTGTGTGTTTGGAGGAGGG + Intergenic
1197614978 X:128680853-128680875 CTGTGTGTGTGTTTGGGGGATGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197970758 X:132112603-132112625 CTGCATGTGTGAAAGATGGAAGG + Intronic
1198025545 X:132702794-132702816 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1198218402 X:134577773-134577795 GTGTGTGTGTGTGTAGTGGAGGG + Intronic
1198226117 X:134647436-134647458 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1198439195 X:136645639-136645661 CTGTCAGTGTGAAAGATGGATGG + Intergenic
1198602071 X:138294891-138294913 TTGTGTGTGTGTGGTGTGGAGGG - Intergenic
1198986399 X:142459092-142459114 GTGTGTGTGTGTATAGAGGATGG - Intergenic
1199535254 X:148895431-148895453 ATGTGTGTGTTTAAGGTGGTGGG - Intronic
1199537589 X:148920640-148920662 GTGTGTGTGTATTTGGTGGAGGG + Intronic
1200092806 X:153643708-153643730 CTGCGTGTGTGTTACGGGGAGGG + Intronic
1200252731 X:154562342-154562364 CTGTGTGTGTCTCAGGGGGCTGG + Intronic
1200258818 X:154600725-154600747 GTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1200265036 X:154642074-154642096 CTGTGTGTGTCTCAGGGGGCTGG - Intergenic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1201402158 Y:13614894-13614916 CTGTGAGTCTGTGAGTTGGATGG - Intergenic
1201490879 Y:14540110-14540132 GTGTGTGTGTGTGTGGTGGGGGG + Intronic