ID: 1099727181

View in Genome Browser
Species Human (GRCh38)
Location 12:86447018-86447040
Sequence ATGAACAATACGAAGGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099727181 Original CRISPR ATGAACAATACGAAGGCTAA GGG Intronic
906856502 1:49312030-49312052 ATCAACAATACTATGGCAAAAGG + Intronic
912280793 1:108310932-108310954 ATAACCAATACAAAGTCTAATGG - Intergenic
915927456 1:160033800-160033822 ATGAAGAAAACCAAGGCTTATGG + Intergenic
918731363 1:188001200-188001222 AGGACCAATATGAAGGATAATGG - Intergenic
922208010 1:223465919-223465941 ATGAACAATGGCAAGGCTGATGG - Intergenic
922789027 1:228299738-228299760 ATAAACAATGAGAAGGCAAATGG - Intronic
923382388 1:233434530-233434552 AAGAGCAATTTGAAGGCTAAAGG + Intergenic
1070518073 10:77226311-77226333 AAGAAAAATAGGTAGGCTAAAGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1074495220 10:113974355-113974377 GTGAACAATTCTAAGGATAAGGG + Intergenic
1078143260 11:8706831-8706853 ATGAACAAAAGGAAGGCAGATGG + Intronic
1078643522 11:13117460-13117482 AGGAACAATAGGAATGCAAATGG + Intergenic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1087316014 11:96603628-96603650 AAGAACAATAAGATTGCTAAGGG + Intergenic
1088524756 11:110740524-110740546 ATGAATAGTCAGAAGGCTAAAGG - Intergenic
1094665372 12:32515087-32515109 TTGAACAGAACTAAGGCTAAAGG + Intronic
1099727181 12:86447018-86447040 ATGAACAATACGAAGGCTAAGGG + Intronic
1102264757 12:111473916-111473938 ATGAACAAGACAAAAACTAAGGG + Intronic
1104738193 12:131152932-131152954 ATGAACAATACTCAGGCAGAAGG + Intergenic
1107148356 13:37083999-37084021 ATAAAAAATAGGAAGGCTTATGG - Intergenic
1109187047 13:59282381-59282403 ATGGACAAGGGGAAGGCTAATGG + Intergenic
1110018371 13:70437715-70437737 ATGAAGAAATGGAAGGCTAAAGG - Intergenic
1112483912 13:99802485-99802507 ATAAACAATAGGATGGCTAATGG + Intronic
1114810068 14:25888340-25888362 ATTAACAATACTATCGCTAAAGG + Intergenic
1115388440 14:32825231-32825253 ATGAACAATGATTAGGCTAAAGG + Intronic
1116068868 14:40017626-40017648 ATGAACAAAACCAAGACAAATGG + Intergenic
1120613272 14:86669308-86669330 ATGAAAAATTCAAAGGATAAAGG - Intergenic
1120791222 14:88585078-88585100 TTAAACAATATGAGGGCTAAGGG - Intronic
1121971575 14:98361977-98361999 ATCACCAATATGAATGCTAAAGG - Intergenic
1122026633 14:98882324-98882346 ATGGACAATACGTAAACTAATGG + Intergenic
1129278919 15:74468284-74468306 ATAAAAATTAGGAAGGCTAATGG - Intergenic
1129946300 15:79541988-79542010 ATGAACAATACAAGGACTCAGGG + Intergenic
1130773946 15:86956988-86957010 AGGAACAATACAAAGGCAATTGG + Intronic
1132061296 15:98694382-98694404 ATGAGCCATAGGAAGGCTTAGGG + Intronic
1133654776 16:7850260-7850282 ATAAAGAATACTGAGGCTAAAGG + Intergenic
1146813298 17:35921546-35921568 ATGACCAATTCCAAGGCTCACGG + Intronic
1154276965 18:12970141-12970163 GTGCACAATACTGAGGCTAAAGG + Intronic
1157904136 18:51552493-51552515 ATGAATAATTCAAAGGTTAAGGG - Intergenic
1159741072 18:72171467-72171489 AAGAACAATATAAAGGATAATGG - Intergenic
1168179555 19:54651811-54651833 ATGAACAAAACGAGGCTTAATGG - Intronic
926737563 2:16084982-16085004 TTGAACAATAACATGGCTAAAGG + Intergenic
927857424 2:26536223-26536245 ATGAACAAAATGAAGGGTTATGG - Intronic
928708955 2:33982793-33982815 ATGAACAATACAAACATTAATGG + Intergenic
930397911 2:50846768-50846790 ATGAACCAAAGGAAGGATAAAGG - Intronic
930628756 2:53728679-53728701 CTTAACAGTACAAAGGCTAATGG + Intronic
931264895 2:60652031-60652053 AGGAACTAAACTAAGGCTAAAGG + Intergenic
933840464 2:86282205-86282227 AGGAATAATACGCAGGGTAAAGG + Exonic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
939084666 2:137705068-137705090 TTGAACAACGTGAAGGCTAAGGG - Intergenic
939669520 2:144993199-144993221 ATGAAGAATACTAAAGGTAAAGG - Intergenic
941002614 2:160217750-160217772 TTTACCAATAAGAAGGCTAAGGG - Intronic
941838156 2:170049027-170049049 TTGAACAACACAGAGGCTAAGGG + Intronic
1169475181 20:5924485-5924507 ATGAACAATAAGAGGACCAAGGG - Intronic
1173320097 20:41979785-41979807 ATGAAAAAAATGAAGGCAAAGGG + Intergenic
1173411345 20:42812973-42812995 ATGAACATAAAGAAAGCTAAAGG - Intronic
1174008466 20:47429087-47429109 AAGACCAAGACGAAGGCTTAGGG + Intergenic
951518743 3:23590948-23590970 ATGAACAATACAAAGCTTGAGGG - Exonic
956555450 3:70517058-70517080 ATAAATAATAAGAAAGCTAAGGG - Intergenic
956699150 3:71943458-71943480 TTGAACAACATGGAGGCTAAGGG + Intergenic
957411324 3:79844887-79844909 ATGAACAATAAAATAGCTAAAGG - Intergenic
957549269 3:81682577-81682599 ATGCACACTAGGATGGCTAATGG + Intronic
964249458 3:154694791-154694813 GTGAACAATACAATGGCTATCGG + Intergenic
967197908 3:187045013-187045035 ATCAACAATACAAAGGGGAAAGG + Intronic
969125678 4:4946093-4946115 ATGAAAAATAGGAAGCCTCAGGG + Intergenic
969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG + Intergenic
971292817 4:25360166-25360188 ATTAACAAGACCATGGCTAATGG - Intronic
971732601 4:30405179-30405201 TTGAACAATACAGAAGCTAAGGG - Intergenic
972819170 4:42679786-42679808 ATGAACAATAGGAATGAAAAGGG + Intergenic
973019024 4:45176941-45176963 ATGAACAAGAACAAGGCTCAAGG + Intergenic
976441397 4:85079570-85079592 CTGACCAATACGTAGGCAAATGG + Intergenic
981903982 4:149898521-149898543 AGGCACAATACCAATGCTAATGG + Intergenic
982442404 4:155452449-155452471 TTCAACTATAAGAAGGCTAATGG - Intergenic
983412219 4:167416229-167416251 ATAAACAATATGTAAGCTAATGG - Intergenic
984547317 4:181122104-181122126 ATGAATAATATGTAGGCAAAGGG - Intergenic
987523188 5:19014039-19014061 TTCAACAATAAGAAGGCTATTGG - Intergenic
988735761 5:34019407-34019429 ATGAACATTACAAAGACTTAAGG + Intronic
989255326 5:39360200-39360222 ATGATAAATACAAAGGCTTAAGG - Intronic
993044541 5:82852589-82852611 ATGAAAACTAAGAAGGCGAAGGG + Intergenic
996272893 5:121629802-121629824 ATGAAAAATATGAAAGTTAAAGG - Intergenic
997758948 5:136426105-136426127 ATGAAAAATACGAAGAGGAAAGG - Intergenic
999993938 5:157073924-157073946 TTGAACAATATGAGGGCTAGTGG - Intergenic
1000075498 5:157781231-157781253 AAGAATAATTCGCAGGCTAAAGG - Intergenic
1001925367 5:175632265-175632287 TTGAACAATGTGAAGGCTAAGGG + Intergenic
1004118060 6:12790505-12790527 ATGAACAATGCGAAAGCAAGAGG - Intronic
1008505175 6:52223140-52223162 ATGAAAGATACCAAGGCTAAAGG - Intergenic
1008914946 6:56777303-56777325 AAGAGAAATACGAAGGCAAAAGG + Intronic
1010847036 6:80721119-80721141 ATGAACAATACTCAGGCAGAAGG + Intergenic
1012128379 6:95458578-95458600 CAGAACAAAACGAAAGCTAAAGG + Intergenic
1013935755 6:115591076-115591098 ATGAACAATATGATGTATAAAGG - Intergenic
1015083900 6:129264107-129264129 ATGAATAATAGGAAGGAGAAGGG + Intronic
1017150184 6:151272466-151272488 ATGAAAAACAGGAAGGCAAAGGG - Intronic
1023383104 7:39627959-39627981 ATGAAAAATATGAAAGATAAAGG - Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1037689669 8:21171414-21171436 ATGAACAAGACCAAGTCTTAAGG - Intergenic
1044103944 8:88177731-88177753 ATGTAATATACGAAGGCAAAAGG - Intronic
1045668887 8:104524554-104524576 ATAATGAATATGAAGGCTAAGGG + Intronic
1045887468 8:107115696-107115718 AAGAACAAAGCGAAGGTTAAAGG + Intergenic
1046816839 8:118594447-118594469 TTGAAAACTACGAAAGCTAAAGG + Intronic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1050353777 9:4763986-4764008 ATGTACAATATTAAGGATAATGG + Intergenic
1056014981 9:82376045-82376067 ATGAACAATACGTAAGTGAATGG + Intergenic
1059916167 9:119104295-119104317 ATGAACAATGTGTGGGCTAAGGG + Intergenic
1186479098 X:9882536-9882558 ATGAACATTACAGAGGTTAATGG + Intronic
1186749345 X:12605657-12605679 AGGAACAATCTGAAGGCTAGTGG - Intronic
1187000575 X:15172533-15172555 ATGAACAATACATAAGCAAATGG + Intergenic
1189051435 X:37649864-37649886 ATGATGAAGACGAGGGCTAAAGG - Intronic
1193762262 X:85481582-85481604 ATGAATAAAATAAAGGCTAAGGG - Intergenic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic