ID: 1099735124

View in Genome Browser
Species Human (GRCh38)
Location 12:86557502-86557524
Sequence GTCCTCAGGCACCATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099735124 Original CRISPR GTCCTCAGGCACCATGGTGG TGG (reversed) Intronic
900246716 1:1639703-1639725 GCCCACAGGCACCAAGGAGGGGG + Intronic
900257937 1:1706835-1706857 GCCCACAGGCACCAAGGAGGGGG + Intronic
900579639 1:3402688-3402710 GCCCTGAGGCACCGTGGTGAGGG + Intronic
901296069 1:8161792-8161814 CTTCTCAGGCCCCGTGGTGGTGG + Intergenic
901796786 1:11684153-11684175 GGCCTCAGGTTCCATGGGGGCGG + Intronic
902048582 1:13544039-13544061 GTCTCCAGGCATCATGCTGGGGG + Intergenic
902833433 1:19032544-19032566 ATCCTAAGGCACCAGGGTGGCGG + Intergenic
903053426 1:20618528-20618550 GTCCTCAGGCCCAAAGGAGGAGG - Exonic
904567075 1:31434493-31434515 GTCCTCAGGCTCCACGGGAGCGG + Exonic
906537576 1:46560171-46560193 GCTCTCAGCCACCATGGGGGTGG - Intronic
907307799 1:53523198-53523220 CTCCTCAGGGAACATGGAGGTGG + Intronic
907609848 1:55857734-55857756 GTCCTCAGACTGCATGGTTGAGG + Intergenic
907927307 1:58966570-58966592 GGCCTCAGGGGCCATGGGGGTGG + Intergenic
908417114 1:63923903-63923925 GTCCTCAGGCCCCCTGGTTTTGG - Intronic
908644823 1:66265949-66265971 GTCCTCAGTAACCATGAGGGTGG + Intronic
908789817 1:67770444-67770466 GTCCCCTTGCCCCATGGTGGAGG + Intronic
914340292 1:146754394-146754416 GTCCTCACACACCATGATTGTGG + Intergenic
915410351 1:155696909-155696931 GTCTTTAGGGAGCATGGTGGGGG + Intronic
916677418 1:167075589-167075611 CTCCTTAGACACCCTGGTGGAGG + Intronic
918150874 1:181797318-181797340 TTCCTTAGGCACCAAGCTGGTGG - Intronic
918374627 1:183896836-183896858 GTCCTCAGGCACCAGGAGGAAGG + Intronic
919101264 1:193099966-193099988 AACCTGAGGCAGCATGGTGGAGG - Intronic
920791881 1:209100781-209100803 GGCCTGAGGCAGCATGTTGGTGG + Intergenic
922583596 1:226717515-226717537 GTCCTCAGCCACCATCTCGGAGG + Intronic
924653265 1:245949314-245949336 GTCCTTGGGCCCCACGGTGGCGG - Intronic
1065172858 10:23049348-23049370 CTCCACAAGCACCATGGTTGGGG + Intergenic
1065775792 10:29119082-29119104 GTCATCAGGGTCCATGCTGGAGG + Intergenic
1067673869 10:48351973-48351995 GTCCACAGGCTCCAGAGTGGTGG - Intronic
1070610390 10:77928187-77928209 GTCCTTAGGAAAAATGGTGGAGG + Intergenic
1073119279 10:101111640-101111662 GTGCTCATGCCCCATGGAGGGGG - Intronic
1075958548 10:126546448-126546470 CTCCTCTGGCACCATCCTGGTGG - Intronic
1076204912 10:128589386-128589408 GTCCTCAAACACCGTGGTGAAGG - Intergenic
1077516266 11:3003820-3003842 GGCCCGAGGCACCATGGGGGAGG - Intronic
1077550962 11:3200108-3200130 GTCCTCAGGCTGCATCCTGGGGG - Intergenic
1077581885 11:3422482-3422504 CTCCTCGGGCACCATGACGGGGG + Intergenic
1077858402 11:6152313-6152335 GGCCTTAGGCACAGTGGTGGTGG + Intergenic
1079098018 11:17523336-17523358 GGCCCCAGGCTCCAGGGTGGTGG + Intronic
1079313427 11:19387240-19387262 GTGCTCAGGGAGCATGGTGGCGG + Intronic
1083478296 11:62927618-62927640 GTTCTCAGGCTCCAAGCTGGGGG - Intergenic
1084689979 11:70719506-70719528 GCCCGCATGCAGCATGGTGGAGG + Intronic
1084768560 11:71327858-71327880 GTCCTCAGTCCCCATCGTGTTGG + Intergenic
1089582346 11:119489300-119489322 GTCCTGATGGACCAGGGTGGGGG + Intergenic
1091243176 11:134068936-134068958 TTCCTCTGTCACCATGGTGCCGG + Exonic
1097558206 12:61166681-61166703 GTCCTCAGGGCCTATGATGGAGG + Intergenic
1098155161 12:67589906-67589928 GTCATCAAGAAACATGGTGGAGG - Intergenic
1099735124 12:86557502-86557524 GTCCTCAGGCACCATGGTGGTGG - Intronic
1102778715 12:115544169-115544191 ATCCTCCTGCACCATGGAGGAGG - Intergenic
1102958360 12:117074518-117074540 GGCCTCAGGCAAGATGGGGGTGG - Intronic
1104729774 12:131098347-131098369 GGCCTCAGAAGCCATGGTGGGGG + Intronic
1104762341 12:131305062-131305084 GTGTGCAGGCACCATGGCGGGGG + Intergenic
1106723089 13:32455732-32455754 ATCCTCAGGCCCCAGGGTAGTGG - Intronic
1109548474 13:63860451-63860473 GTCCTCAGGTCCCACGTTGGCGG - Intergenic
1109943451 13:69401827-69401849 GTCCTAATGTACCAAGGTGGTGG - Intergenic
1116139570 14:40974358-40974380 ATCCTCAGGCACCATGATCTTGG - Intergenic
1121321789 14:92995786-92995808 GTCCCCAGGCTCCATGTGGGCGG - Intronic
1121457374 14:94047022-94047044 GTCCTGAGGCAGCAAGGTGAGGG - Exonic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1122047922 14:99036485-99036507 GTCCTGAGGCTTCCTGGTGGAGG + Intergenic
1123118816 14:105907658-105907680 GTCCTCTGGCCCTATGGTGTGGG + Intergenic
1128890964 15:71331509-71331531 CTCCACAGGCACCATGGGGCGGG + Intronic
1129725296 15:77898541-77898563 ACCCTCAGGCACCATGAGGGAGG - Intergenic
1131286728 15:91065545-91065567 TCTCTCAGGCCCCATGGTGGAGG + Intergenic
1131639035 15:94270024-94270046 GTATTCAGGCACCATGCTTGTGG + Intronic
1132045512 15:98559920-98559942 GACCTCAGGCTCCAAGGTGAGGG - Intergenic
1132110539 15:99099389-99099411 GTGCTAAGGCACCAGGGTGGGGG + Intronic
1132959318 16:2613247-2613269 GTCCTCACGCACCTGGGTGGAGG - Intergenic
1132972378 16:2695222-2695244 GTCCTCACGCACCTGGGTGGAGG - Intronic
1133677796 16:8091786-8091808 GTCATCAGGCATTATGGTGAAGG - Intergenic
1136287111 16:29250987-29251009 GGCTTCAGGCACCAGGGTCGAGG - Intergenic
1138594244 16:58021248-58021270 CTCCCCAGGCACCTTGCTGGGGG - Exonic
1139440653 16:66964994-66965016 TGCCCCAGGCAGCATGGTGGAGG + Intronic
1139488115 16:67270855-67270877 GTCCACAGGCACAATCTTGGTGG - Exonic
1139576152 16:67843298-67843320 GTCGTCAGGCACCACGGAGGAGG + Exonic
1140322527 16:73967038-73967060 GTCCCCCGGGACCCTGGTGGTGG - Intergenic
1141938077 16:87255223-87255245 GTCCACAGGCACAAGGCTGGGGG + Intronic
1142092716 16:88223619-88223641 GGCTTCAGGCACCAGGGTCGAGG - Intergenic
1142210563 16:88806508-88806530 GTCCTCCGGCACCACCATGGCGG - Exonic
1142262767 16:89050480-89050502 GTCCCCAGTCTCCATCGTGGGGG + Intergenic
1144826228 17:18107194-18107216 GTCCTCATGCTCCATGGTGTGGG - Exonic
1145190720 17:20841147-20841169 GGGCTCAGGCACCAGGGTGTAGG - Intronic
1145912704 17:28551938-28551960 GTCCTCAGCCCCCACGCTGGAGG - Intronic
1146821290 17:35985154-35985176 GGCCTCAGGGACTATTGTGGAGG + Intronic
1147316095 17:39621191-39621213 GTCCTGAGGCTCCAGTGTGGAGG - Intergenic
1148151187 17:45397179-45397201 GTTCTCAGGCTCACTGGTGGAGG - Intronic
1151473030 17:74329751-74329773 GTACACAGGCACAGTGGTGGGGG + Intronic
1151519320 17:74616996-74617018 GTCCTCAGTCACAGTGGTGTTGG - Intronic
1151555714 17:74845798-74845820 GGGCTCAGGCCTCATGGTGGGGG - Intronic
1153972213 18:10237118-10237140 GTCCTCAGCCTTCATGCTGGTGG + Intergenic
1160732050 19:645763-645785 GTCCTCAGGCAGTGAGGTGGGGG + Intergenic
1163458661 19:17423622-17423644 GTCCTCAGGCACCGGAGTGGGGG + Intronic
1163732553 19:18958078-18958100 CTCCTTAGGCAACCTGGTGGTGG + Intergenic
1163831844 19:19550730-19550752 GGCCTCAGGCTCCATCGTGCTGG - Intergenic
1166047226 19:40236576-40236598 GTTCCCAGGTACCATGGGGGTGG - Intronic
1166537127 19:43581281-43581303 GTCCTTGGGGCCCATGGTGGTGG - Exonic
1166888022 19:45973337-45973359 GGCCTCGGGCTCCATGGGGGGGG + Exonic
1167679006 19:50908090-50908112 GCCCTCAGGCCCCATGCTGTTGG + Intronic
1167881732 19:52464923-52464945 GTCTTTAGGGATCATGGTGGGGG + Intronic
1168136467 19:54355495-54355517 GTCCTCAGGGCCCATGGAGATGG - Intronic
1168381218 19:55925329-55925351 ATTATCAGGCACCATTGTGGAGG - Intronic
925072721 2:983807-983829 TTCTCCAGGCTCCATGGTGGAGG - Intronic
925294190 2:2767004-2767026 GCCTGCAGCCACCATGGTGGAGG + Intergenic
925865633 2:8223768-8223790 CTCCTCAGGCTCCAAGGTGCTGG - Intergenic
927252078 2:21005288-21005310 CTGCTCAGGCACGATGATGGTGG + Exonic
933596524 2:84288670-84288692 GTCCTCAGGCAACATCCTGAGGG - Intergenic
935133083 2:100275742-100275764 GTGCCCAGGCACACTGGTGGGGG - Exonic
937352465 2:121174944-121174966 GGCCTCAGGCACCGTGGCCGGGG - Intergenic
941489866 2:166129977-166129999 GTCCTGAGTCCCCATGGTGAGGG - Intergenic
941638376 2:167960778-167960800 GTTCTCAGACTCTATGGTGGGGG - Intronic
941912014 2:170772718-170772740 ATCCTCAGGGAGCTTGGTGGGGG - Intergenic
947799867 2:232922017-232922039 GTACCCAGGCACCCAGGTGGAGG + Intronic
947825654 2:233104585-233104607 GTCCTCATGGGCCATGGTTGGGG + Intronic
948922578 2:241072669-241072691 CTCCTCAGACACCTTGCTGGGGG - Intronic
1169124941 20:3120850-3120872 GTCCTCATGCCACATGGTGAGGG + Intronic
1169678015 20:8176850-8176872 GTCCTCAGGCACTACTCTGGAGG - Intronic
1170646657 20:18202855-18202877 GTCCTCAGGCCCCCAGGTGGTGG + Intergenic
1170736502 20:19017723-19017745 ATTCTCAGGCAGCATGGTGTTGG - Intergenic
1171148224 20:22804214-22804236 GTGCTCAGGCCCCATGGGGGAGG - Intergenic
1171777344 20:29381261-29381283 GGCCTCAGGGCCCATGATGGTGG + Intergenic
1172607928 20:36227626-36227648 GGCCTCAGGCACCAGGCTGGTGG - Intronic
1172822578 20:37750859-37750881 TTCCACACACACCATGGTGGGGG - Intronic
1173235261 20:41239487-41239509 GTCCTCAGCAAGCATGCTGGTGG + Intronic
1174981389 20:55399240-55399262 CTCCTCTGACACCATGGGGGTGG - Intergenic
1175311802 20:58017640-58017662 CTCATCAGTCACCCTGGTGGGGG - Intergenic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1176795756 21:13370471-13370493 CCCCTCAGGCACCCTAGTGGGGG - Intergenic
1178772109 21:35515192-35515214 GTCATCAGGCCCCAGGGTAGAGG - Intronic
1181021195 22:20104118-20104140 GGCCTCAGGCAGCTTGGTGCAGG + Intronic
1181084416 22:20432670-20432692 GGGCTCAGGGACCAGGGTGGAGG + Intronic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1181556468 22:23674460-23674482 CTCCCCAGGCAGCATGGGGGCGG + Intergenic
1184095727 22:42315274-42315296 GTGCTCACACACCATGCTGGGGG + Intronic
949924990 3:9033906-9033928 GCCCTAAGGCTCCATGATGGTGG - Intronic
950184961 3:10939290-10939312 GTCCTCAGCCCCCATGGCAGGGG + Exonic
951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG + Intergenic
954472197 3:50707631-50707653 GTCCTTGGGCACAGTGGTGGTGG + Intronic
954709120 3:52496256-52496278 CTGCTCAGGCCCCATGGTAGGGG + Intronic
954958314 3:54541550-54541572 GTTCTAAGCCACCCTGGTGGTGG + Intronic
960674485 3:120181268-120181290 GTCCTTAACCATCATGGTGGGGG - Exonic
961347659 3:126274508-126274530 GTCTTCCGCCACCATGGGGGTGG - Intergenic
961741058 3:129033357-129033379 GTCCTCGGTCCCCATGGGGGTGG - Intronic
962985143 3:140529345-140529367 GGCCTCAGGCATCATTCTGGGGG + Intronic
972586203 4:40438819-40438841 GCCCTCGGGCACCTTGGCGGAGG + Exonic
972801327 4:42478665-42478687 GTCCTCTAGCACCTTGCTGGGGG + Intronic
976213176 4:82692241-82692263 GTCCTCAGGACCCATGGCAGTGG - Intronic
977028442 4:91851671-91851693 GTGCTCTGGCAGGATGGTGGGGG - Intergenic
977249835 4:94677363-94677385 GTCCTCAGGGACCTTGCTGTGGG + Intergenic
981254651 4:142647508-142647530 GGCGTTAGGCACCATTGTGGTGG - Intronic
981455441 4:144948044-144948066 ATCCTCTGGCACCACTGTGGTGG + Intergenic
984511373 4:180682987-180683009 GCCCACAGCCACCATGGTGGTGG + Intergenic
984846732 4:184114902-184114924 GTTCTCAGGCTCCATGGTCAGGG - Intronic
986552527 5:8974284-8974306 GTCCTCGGGCTCCCTGGTGGTGG + Intergenic
995072645 5:107942207-107942229 GAGCTGAGGAACCATGGTGGTGG - Intronic
998935121 5:147226672-147226694 GTCCTGCGTCGCCATGGTGGTGG - Intergenic
1002724368 5:181284442-181284464 CCCCTCAGGCACCCTAGTGGGGG + Intergenic
1004265957 6:14148698-14148720 CTGCCCAGGCAGCATGGTGGTGG + Intergenic
1005425828 6:25701612-25701634 TTCCCCAGTCACCAGGGTGGGGG + Exonic
1006780337 6:36628096-36628118 GAGCTCAGGCAGAATGGTGGAGG + Intergenic
1007213372 6:40216400-40216422 TGGCTCAGGCACCATGGTGAAGG + Intergenic
1007216982 6:40248025-40248047 CTCCTCAGCCACCATGAGGGAGG - Intergenic
1007350853 6:41272469-41272491 GTCCTTGGGAACCATGGTGCGGG - Intronic
1009503380 6:64444911-64444933 GCCCTCAGAAATCATGGTGGAGG - Intronic
1011621072 6:89243051-89243073 GTCCTCAGACAACATGCTGAGGG - Intergenic
1016900192 6:149093308-149093330 ATCCACAGGCACTATGCTGGTGG - Intergenic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1024605126 7:51016734-51016756 GTACACAGGCACCGTGGGGGAGG + Exonic
1026542964 7:71296892-71296914 GTGTTCACGCACCATGATGGAGG - Intronic
1028972150 7:96871249-96871271 CTGCTCAGGCAGAATGGTGGTGG + Intergenic
1029440634 7:100585013-100585035 ATCCACAGACACCAGGGTGGAGG + Intronic
1032018304 7:128393287-128393309 GTCCTCAGTGCCCAGGGTGGAGG + Intronic
1033137093 7:138794576-138794598 GTGGCTAGGCACCATGGTGGTGG - Intronic
1035157376 7:156925231-156925253 GACCTCAGGCCCCATGGTTATGG - Intergenic
1036792455 8:11730537-11730559 GTCCTCAGGCCCCTACGTGGAGG - Intronic
1037392246 8:18405646-18405668 TTCCTCAGATACCATGCTGGTGG + Intergenic
1037540052 8:19862308-19862330 CTCCTCAGCCACCCTGGTTGTGG + Intergenic
1037584459 8:20267166-20267188 CCTCTCAGGCACCCTGGTGGAGG + Intronic
1039150409 8:34498574-34498596 CTCCTCAGAGACCATGGAGGTGG - Intergenic
1041131733 8:54709097-54709119 TTCCTAAGGCCCCATTGTGGAGG + Intergenic
1041464363 8:58144120-58144142 GTCCTCAGGCACAAAGCTGAAGG + Intronic
1043824118 8:84903953-84903975 GTACTCAGGCACCATTGTAAGGG + Intronic
1048049885 8:130806769-130806791 GCCCTCAGGCACCCAGGTGAGGG - Intronic
1049435543 8:142584612-142584634 GACTTCAGGCGGCATGGTGGGGG - Intergenic
1049467225 8:142757111-142757133 GTCCCCAGGCCCCATGTGGGAGG + Intergenic
1049579909 8:143406528-143406550 GTCCTCAGGGACAGTGGAGGAGG + Intergenic
1052374483 9:27702796-27702818 GTCATCAGGAACCAAGGTGTTGG + Intergenic
1052982299 9:34458254-34458276 GCCCGCCGGCACCATGATGGAGG - Exonic
1053344647 9:37369632-37369654 CTCCACAGGCTCCCTGGTGGTGG - Intergenic
1053886503 9:42647874-42647896 CCCCTCAGGCACCCTAGTGGGGG + Intergenic
1054225522 9:62455323-62455345 CCCCTCAGGCACCCTAGTGGGGG + Intergenic
1054737519 9:68770390-68770412 GTCCTCCTGCACCTTGCTGGGGG + Intronic
1055829261 9:80359933-80359955 GTCCTCAGGGACCCTGGGTGCGG + Intergenic
1056799262 9:89680122-89680144 GTCCCCGGGCACTGTGGTGGTGG + Intergenic
1061709331 9:132476898-132476920 GCCTTCAGCCACCAAGGTGGTGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062332184 9:136049681-136049703 GGCCTACGACACCATGGTGGAGG - Exonic
1185886132 X:3784999-3785021 GTCCCCAGGGACCATGATGAGGG - Intergenic
1187482524 X:19670943-19670965 GTCCTCAGGCTCCGTGCTGTTGG - Intronic
1187713020 X:22073277-22073299 GTGCCCAGGCACCAAGATGGGGG + Intronic
1193277385 X:79604979-79605001 GTACTCAGATGCCATGGTGGGGG + Intergenic
1198341142 X:135714101-135714123 GTTCTCATGGAACATGGTGGGGG + Intronic
1199771958 X:150980901-150980923 GTTGGCAGGCACCTTGGTGGGGG - Intronic
1201347275 Y:12999183-12999205 GTCTTTAGGGAGCATGGTGGGGG + Intergenic