ID: 1099738209

View in Genome Browser
Species Human (GRCh38)
Location 12:86597787-86597809
Sequence CTTTTTAAAGGGATTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 14, 3: 64, 4: 624}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099738209_1099738215 -8 Left 1099738209 12:86597787-86597809 CCATCCACAATCCCTTTAAAAAG 0: 1
1: 0
2: 14
3: 64
4: 624
Right 1099738215 12:86597802-86597824 TTAAAAAGTCCTGTGGGAGATGG 0: 1
1: 0
2: 4
3: 27
4: 297
1099738209_1099738216 0 Left 1099738209 12:86597787-86597809 CCATCCACAATCCCTTTAAAAAG 0: 1
1: 0
2: 14
3: 64
4: 624
Right 1099738216 12:86597810-86597832 TCCTGTGGGAGATGGATTTGAGG 0: 1
1: 13
2: 57
3: 149
4: 463
1099738209_1099738219 24 Left 1099738209 12:86597787-86597809 CCATCCACAATCCCTTTAAAAAG 0: 1
1: 0
2: 14
3: 64
4: 624
Right 1099738219 12:86597834-86597856 ACTTCTCCCACCTCCTCCCTTGG 0: 1
1: 0
2: 2
3: 77
4: 535
1099738209_1099738218 1 Left 1099738209 12:86597787-86597809 CCATCCACAATCCCTTTAAAAAG 0: 1
1: 0
2: 14
3: 64
4: 624
Right 1099738218 12:86597811-86597833 CCTGTGGGAGATGGATTTGAGGG 0: 1
1: 5
2: 25
3: 66
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099738209 Original CRISPR CTTTTTAAAGGGATTGTGGA TGG (reversed) Intronic
901564235 1:10099379-10099401 CTTTTTAATGAAATTGTGAATGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
903057676 1:20647778-20647800 CTTTTTAAAGGAATTTTGTGTGG + Intronic
903083525 1:20833361-20833383 CTTTTTGAAGCAATTGTGAATGG + Intronic
903089557 1:20899606-20899628 CTTTTTAGAGAGATACTGGATGG - Intronic
903248232 1:22032661-22032683 CATTTTAATGGAATTCTGGAAGG + Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
905164940 1:36074951-36074973 CTTTATAAAGGCATTGTAGCTGG - Intergenic
905437984 1:37972247-37972269 CTCTTTGAAGGAATTGTGAAGGG - Intronic
906861575 1:49366348-49366370 CTTTTTGAAGGCATTGTGCCAGG - Intronic
907811818 1:57878536-57878558 CTTTTTAAAATTATTTTGGATGG + Intronic
907910615 1:58822729-58822751 CTTTATAAAAGGATAGGGGAAGG + Intergenic
908083457 1:60605533-60605555 CTTTTTATAGCAATTGTGAATGG - Intergenic
910067577 1:83171812-83171834 CTTTTTGAAGCAATTGTGAATGG - Intergenic
910354881 1:86342467-86342489 CTCTTTAAAGGTAATGCGGAGGG - Intergenic
910624730 1:89294091-89294113 CATTCAAAAGGGAATGTGGATGG - Intergenic
910829518 1:91446241-91446263 CTTTTTATAGCAATTGTGAATGG - Intergenic
911079317 1:93912472-93912494 CTTTTCAAAGCAATTGTGAATGG + Intergenic
911106684 1:94138485-94138507 CTTTTTGAAGCAATTGTGAATGG - Intergenic
911202885 1:95064031-95064053 CTTTTTGCAGTGATTGTGAATGG + Intronic
911290670 1:96053328-96053350 CTTTTTGAAGCAATTGTGAATGG + Intergenic
911638274 1:100260080-100260102 CTTTTTGAAGCAATTGTGAATGG + Intergenic
912035496 1:105306999-105307021 CTTTTTGAAGCAATTGTGAATGG + Intergenic
912149379 1:106838798-106838820 CTATTATAAGGGATTGGGGAAGG - Intergenic
912742725 1:112216034-112216056 CTTTTTGAAGCAATTGTGAATGG - Intergenic
913054667 1:115147048-115147070 CTTTTTAACGGGATTATTGGGGG - Intergenic
913408376 1:118521331-118521353 CTTTTTGAAGCAATTGTGAATGG + Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915759760 1:158298765-158298787 CTCTTTGAAGCGATTGTGAATGG + Intergenic
915760616 1:158308222-158308244 CTTTTTGAAGCAATTGTGAATGG - Intergenic
915761326 1:158316407-158316429 CTCTTTAAAGCAATTGTGAATGG + Intergenic
915856316 1:159390562-159390584 CTCTTTAAAGCAATTGTGAATGG + Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916891629 1:169117311-169117333 CTTGGTAAAGGGTTTGTGGGGGG + Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917583759 1:176404233-176404255 CTTTTTGTAGGAATTGTGAATGG + Intergenic
917842138 1:178989349-178989371 CTTTTTGAAGCAATTGTGAATGG + Intergenic
917911062 1:179646841-179646863 CTCTTTGAAGCAATTGTGGATGG - Intronic
919571510 1:199254759-199254781 CTTTTTACAGCTATTGTAGAAGG + Intergenic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920889927 1:209974962-209974984 CTTTTTGAAGCAATTGTGAATGG + Intronic
920903163 1:210132519-210132541 CTTTATAGAGGGACTGTCGAGGG - Intronic
921150202 1:212394827-212394849 CTCTTTAAAGCTATTGTGAATGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
921425203 1:214993425-214993447 CTATTTATAGGGTTTGGGGAGGG - Intergenic
921825071 1:219663346-219663368 CTTTTTAAAGGGGTGGTGGCTGG - Intergenic
921831140 1:219729010-219729032 CTCTTTAAAGCAATTGAGGATGG + Intronic
922089749 1:222384501-222384523 CTTTTTGAAGCAATTGTGAATGG + Intergenic
922186795 1:223282480-223282502 CTTTTTGAAGCAATTGTGAATGG - Intronic
922411969 1:225385620-225385642 CTTTTTGAAGCAATTGTGAATGG - Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
922568713 1:226619084-226619106 CTTTTTCAAAGGATTCTGGATGG - Intergenic
923240534 1:232081093-232081115 CTTTTTGAAGCAATTGTGAATGG - Intergenic
923475345 1:234326477-234326499 ATTTTTAAAGGGACTATGAAGGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924442999 1:244102522-244102544 CTTTTTAAAGGTAGTGTGTGTGG + Intergenic
924530511 1:244889812-244889834 TTTTTTTAAGAGATTGGGGATGG + Intergenic
924553474 1:245099294-245099316 CTTTTTCAACAGATTGTTGAAGG + Intronic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1064475190 10:15680622-15680644 ATTTTTAAAAGGCTTGTGCATGG - Intronic
1064834300 10:19508192-19508214 CTTTTTCAAAGAGTTGTGGATGG + Intronic
1065586045 10:27218275-27218297 CCCTTCAAAGGGATTGTGGTAGG - Intronic
1066019727 10:31286276-31286298 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1066433084 10:35371441-35371463 CTTGTTCAAAGGAGTGTGGATGG - Intronic
1066452217 10:35540571-35540593 TTTTTTGAAGAGTTTGTGGAAGG + Intronic
1066500164 10:35985251-35985273 CTTTTTAAATGTAATGAGGATGG - Intergenic
1066934219 10:41805329-41805351 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1067710016 10:48641978-48642000 CTCTTTGAAGGAATTGTGAATGG - Intronic
1068082814 10:52340761-52340783 CATCTTCAAGGGTTTGTGGATGG - Intergenic
1068169437 10:53374479-53374501 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1068296123 10:55074545-55074567 CTTTTTAATGGGGTTGTTTATGG + Intronic
1069511330 10:69044684-69044706 CTTTTGCAAGGGACTGTGGCAGG - Intergenic
1069659082 10:70111742-70111764 CTTTTTAAAAGGAGAGAGGAGGG + Exonic
1070852604 10:79579476-79579498 ATTTTTAAAGTGATTGTAAATGG - Intergenic
1071080959 10:81810551-81810573 CTTTTTAAAGAAATCATGGAAGG - Intergenic
1071202851 10:83239883-83239905 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072360736 10:94656583-94656605 CTTTTGAATGGGATTTTTGAGGG + Intergenic
1072601196 10:96931582-96931604 TCTTTTAAAGGAGTTGTGGAAGG - Intronic
1073746250 10:106471543-106471565 CTTTTTGTAGTGATTGTGAATGG - Intergenic
1073825400 10:107314968-107314990 CGTTGTAAAGTGATAGTGGATGG + Intergenic
1074620916 10:115120714-115120736 CTATTTAAATGTATTGTGAATGG + Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1076339535 10:129734310-129734332 CTCTTTGAAGTGATTGTGAATGG + Intronic
1077294278 11:1817448-1817470 CTTTTTGAAGGGAGTTTGGTGGG - Intergenic
1077857937 11:6147900-6147922 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1078283158 11:9923110-9923132 CTTTTAAAAGGGAGTTTGGCAGG - Intronic
1078483048 11:11696252-11696274 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079765628 11:24388643-24388665 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1080398177 11:31909216-31909238 CTCTTTAAAGCAATTGTGAATGG - Intronic
1080591540 11:33727911-33727933 CTTTTTATAGCAATTGTGAATGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082223967 11:49678735-49678757 CTTTTTAATGGGAATGGTGATGG - Intergenic
1082589490 11:54988399-54988421 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1082605998 11:55234576-55234598 CTCTTTAAAGCTATTGTGAATGG + Intergenic
1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG + Intergenic
1083389102 11:62334961-62334983 CATTTTAGAGGGATTTTTGAAGG - Intergenic
1083498699 11:63082899-63082921 CCTTTTATAGCTATTGTGGAGGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084993456 11:72951785-72951807 ATTTATAAAGAGATTGTGAAAGG - Intronic
1085674355 11:78501653-78501675 CTTTTTAAAAGGTTTTTTGATGG + Intronic
1085993807 11:81886034-81886056 CTGTTTAATAGGATTCTGGATGG + Intergenic
1086517666 11:87631596-87631618 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1086625073 11:88940427-88940449 CTTTTTAATGGGAATGGTGATGG + Intronic
1086629671 11:89002049-89002071 CATTTTAAAAGGCATGTGGAAGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087251732 11:95908235-95908257 TTTTTTATAGGTATTGTGAATGG - Intronic
1087351760 11:97041911-97041933 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1088171460 11:107002201-107002223 CTGTTGAAAGGTAGTGTGGAAGG - Intronic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089106357 11:116009283-116009305 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1089179729 11:116574512-116574534 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089561380 11:119344992-119345014 CTTCTTGCAGGGTTTGTGGAAGG - Exonic
1091822935 12:3490385-3490407 CTTTTTTAAGGGAGTTTGGGCGG - Intronic
1091829273 12:3538131-3538153 CTTTTTGAACGGATTTTGGCAGG - Intronic
1092623596 12:10301468-10301490 AATTTTTAAAGGATTGTGGAGGG - Intergenic
1092827102 12:12410976-12410998 CTCTTTGAAGGAATTGTGAATGG + Intronic
1093614866 12:21210810-21210832 CTCTTTAAAGCAATTGTGAATGG + Intronic
1094862238 12:34480685-34480707 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1095072233 12:37867353-37867375 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1095534743 12:43231980-43232002 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1096047544 12:48576709-48576731 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1096709754 12:53446694-53446716 CACTTTAAAGGGTCTGTGGAAGG - Intergenic
1097792105 12:63825845-63825867 ATTTTTAAATGCTTTGTGGAGGG + Intergenic
1098071442 12:66679909-66679931 CTTTGTGAATGGATTGTGAAGGG - Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098455295 12:70666085-70666107 CTACTTCAAAGGATTGTGGAAGG - Intronic
1098503381 12:71220620-71220642 CTTCTTCAAAGGGTTGTGGATGG - Intronic
1099549285 12:84023041-84023063 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1100273276 12:93046639-93046661 CATTGTAAAGGCATTTTGGAGGG - Intergenic
1100326884 12:93548477-93548499 ATTTTTAAAAAAATTGTGGAAGG - Intergenic
1101770013 12:107740860-107740882 CTTTGTAGAGGGATTGTAGGTGG - Intronic
1103487377 12:121292427-121292449 CTTTTTAAAAAAATTGAGGAGGG - Intronic
1103902537 12:124310820-124310842 CTTTCTGAAGGGGCTGTGGATGG + Intronic
1104677414 12:130721953-130721975 CTTTTTAAAGTTATTATTGAAGG + Intergenic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1106488921 13:30198748-30198770 CTTTTTAAAGTGTTTGTTTAAGG - Intergenic
1106878629 13:34104751-34104773 CTTTTTAGATGGATTTTTGATGG + Intergenic
1106924705 13:34601614-34601636 CTCTTTAAAGGTAAAGTGGAGGG + Intergenic
1107613722 13:42142646-42142668 CTTTTTGAAGCAATTGTGAATGG + Intronic
1107705484 13:43099139-43099161 CTTTTTAATGCTATTGTGAATGG + Intronic
1108332283 13:49400301-49400323 CTTTTTAAAGGCATGGAGGGAGG - Intronic
1108388145 13:49920648-49920670 CTTTTTATATGGATTGTAGTCGG - Intronic
1108404630 13:50087766-50087788 TTTTATAAAGGGAATGTAGATGG - Intronic
1108567080 13:51710679-51710701 CTCTTTGAAGGAATTGTGAATGG - Intronic
1108589625 13:51901658-51901680 CTTTGTAAAGGGACTTGGGATGG - Intergenic
1108603901 13:52017978-52018000 CTTTATAAAGGATTTGAGGAGGG - Intronic
1108892113 13:55274314-55274336 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1109248303 13:59985714-59985736 CTTTTTGAAGCAATTGTGAATGG - Intronic
1109966524 13:69705585-69705607 ATTTTTAAAGGGATTTTGTGTGG + Intronic
1110006145 13:70272697-70272719 ATTTTAAAATGGATTTTGGAGGG + Intergenic
1111248339 13:85571230-85571252 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1111262294 13:85757045-85757067 CATTTTGAAGGGATTTTTGAAGG + Intergenic
1111998225 13:95185979-95186001 TTTTTTAAAGGGAGTGGAGAAGG + Intronic
1112612164 13:100965946-100965968 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1114487591 14:23072160-23072182 CTTTTCCCAGGGATGGTGGAGGG + Intronic
1114857090 14:26461335-26461357 CATTTAAAAGGGATTTTGGGAGG + Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115096414 14:29641871-29641893 ATTTTTAAAGGGATGATGGCAGG - Intronic
1115705583 14:35994698-35994720 CCTTTTAAAGGGCTTGAGGAAGG + Intergenic
1116506519 14:45688983-45689005 CTTTTTACAGGGCTTGTCTAGGG + Intergenic
1116583887 14:46677735-46677757 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1116872128 14:50078229-50078251 CTCTTTAAAGTAATTGTGAATGG - Intergenic
1117506507 14:56408921-56408943 CTTTTTAAAGGGATTGTTTTTGG - Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1119674977 14:76546840-76546862 CTTCCAAAAGGGATTGTGGATGG + Intergenic
1120099654 14:80429986-80430008 CCTTTTAAAAGGATTCTGAAGGG - Intergenic
1123471492 15:20557455-20557477 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1123646511 15:22442900-22442922 CTTATAAAAGGGCTTGTGGGTGG - Intergenic
1123731794 15:23152457-23152479 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1123749931 15:23349839-23349861 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1123991061 15:25683681-25683703 CTTTCTTAAGGGAGTGAGGAGGG - Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124282299 15:28373735-28373757 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1124300402 15:28537880-28537902 CTTATAAAAGGGCTTGTGGGTGG - Intergenic
1124418986 15:29501914-29501936 CTTTTTACTGGTATTGTTGATGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1125152994 15:36554688-36554710 ATTTTTAAAGGGTTTGAGGTTGG - Intergenic
1125400167 15:39293792-39293814 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1125469416 15:39988061-39988083 CTTTTTCGAGAGATTCTGGATGG + Exonic
1125961692 15:43835313-43835335 CTTTTTATAGAGATTGGGGTGGG - Intronic
1126545098 15:49864655-49864677 CTTTTTTAAGGGATTTTAGAGGG + Intronic
1127469060 15:59274189-59274211 CTCTGGAAAGGGATTCTGGAAGG + Intronic
1127506552 15:59603587-59603609 ATTTTTAAAGGTATTTTGGTGGG - Intronic
1127808664 15:62544205-62544227 CTTTTAAAAAATATTGTGGAAGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128426809 15:67550129-67550151 TTTTTTAAAGGGTTTATGGGTGG + Intronic
1128895460 15:71369035-71369057 CTTTTTGAAGCAATTGTGAATGG + Intronic
1129576228 15:76749000-76749022 CTTTGTAAAGTGATTTAGGAAGG - Intronic
1129967177 15:79746840-79746862 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1130182318 15:81643138-81643160 CATTTTTATGGGATTGTGAAAGG - Intergenic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130409182 15:83630630-83630652 CTTTTTAAAGGGGTTTTATAAGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131379063 15:91948865-91948887 GTTATTAAAGGAATTGAGGATGG - Intronic
1131928679 15:97415057-97415079 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1131956393 15:97740570-97740592 CTCTTGGGAGGGATTGTGGACGG - Intergenic
1131973769 15:97919935-97919957 CTTTTTGAAGGGTTTATGAAAGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1136009068 16:27350686-27350708 CTTTTTAAAGCTTTTTTGGAGGG + Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1136731088 16:32413537-32413559 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1136992624 16:35164402-35164424 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138006943 16:53346168-53346190 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1138799227 16:60005944-60005966 CTTTTATATGGGATTGGGGAAGG + Intergenic
1138875464 16:60943181-60943203 CTTTTTAAAGGGGTTTCAGATGG + Intergenic
1139162736 16:64531479-64531501 CTTTCCAAAGGGATTGGAGATGG + Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1141847459 16:86620496-86620518 ATTTTTAAAGCCATTGTGGCTGG + Intergenic
1202995305 16_KI270728v1_random:103733-103755 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1203021992 16_KI270728v1_random:416075-416097 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1143257454 17:5572404-5572426 CTTTTTAATGGGATTGTTTTTGG - Intronic
1145087494 17:19954791-19954813 CCTTTTAAAAGTATTGTGGTTGG - Intronic
1146190250 17:30759110-30759132 CTTTAAAAAGGAATTTTGGAGGG - Intergenic
1146335419 17:31965763-31965785 CTTTAAAAAGGAATTTTGGAGGG - Intronic
1146731939 17:35200562-35200584 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1146752893 17:35398183-35398205 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1148021470 17:44556747-44556769 GTTTTTTAAGGGTGTGTGGAGGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149732352 17:58958877-58958899 ATTTTAAAAGGGATTGGGGCTGG - Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152177923 17:78800148-78800170 CTGGTTAAAGGGGTTTTGGAGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153309071 18:3660176-3660198 TTTTTTAAAAGGATTGGGGGTGG + Intronic
1154460065 18:14574341-14574363 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1155463937 18:26114813-26114835 CTTTTTATAGCAATTGTGAATGG + Intergenic
1155472718 18:26207669-26207691 CTTTTGCAAGGGACTGTGGATGG + Intergenic
1155667875 18:28333421-28333443 TTTTTTAAATGGATAATGGAGGG + Intergenic
1155871922 18:31041202-31041224 CTTTGCGAAGGGATTGAGGATGG - Intronic
1156114578 18:33772548-33772570 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1156842364 18:41624367-41624389 CTTTTTGAAAGGAGTGTGGATGG + Intergenic
1157919743 18:51702354-51702376 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1158101022 18:53830117-53830139 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1158253790 18:55521633-55521655 CTTTTTAGAGCAATGGTGGATGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1159660885 18:71094577-71094599 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1159704470 18:71669370-71669392 CATTTTAAAGAGATTTTAGAAGG + Intergenic
1163031484 19:14547157-14547179 TTTTTTAAAGGGATAATGGTAGG + Intronic
1163045323 19:14637290-14637312 ACTTTTAAAGGGATCATGGAGGG - Intronic
1163378587 19:16949424-16949446 CTTTTTATATGGATTATGGTTGG - Intronic
1163995632 19:21043843-21043865 CTTTTTGTAGCAATTGTGGATGG + Intronic
1164326705 19:24199527-24199549 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1164420933 19:28092014-28092036 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1164430278 19:28181845-28181867 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1165600355 19:37050466-37050488 CTCTTTGAAGGAATTGTGAATGG + Intronic
1166423685 19:42657228-42657250 CTTTTTAGAGGGAATGTCGGGGG - Intronic
925745978 2:7044136-7044158 CTTTTTAAAGCTATTTTGGCTGG + Exonic
926489698 2:13508973-13508995 TTTTGTAAAAGGATTGTAGAAGG + Intergenic
926962151 2:18369375-18369397 TTTTTTAAAAGAATTTTGGAAGG + Intergenic
927334377 2:21905068-21905090 CTTTTTGAAGCAATTGTGAATGG + Intergenic
928881464 2:36101393-36101415 CTCTTTGAAGCAATTGTGGATGG - Intergenic
928882006 2:36107344-36107366 CTCTTTGAAGCAATTGTGGATGG - Intergenic
929174836 2:38966121-38966143 CTTTTTAAAGAGCTTGCGGAAGG - Exonic
929312431 2:40441168-40441190 CTTTTTATAGCAATTGTGAATGG - Intronic
929386043 2:41408550-41408572 CATTTTAATGGGATTTCGGAGGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929943932 2:46356309-46356331 CTTTTGAAAGAGATAGAGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930544143 2:52745816-52745838 CTCTGTAAAGGCAGTGTGGAAGG + Intergenic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930749475 2:54919247-54919269 CTTTTGAAAAGGATTGGGGGGGG - Intronic
931253204 2:60551078-60551100 TTTTTTAAAGGGGTGGTGGTGGG - Intronic
931502947 2:62890488-62890510 CTTTTTGTAGTGATTGTGAATGG + Intronic
931558256 2:63528964-63528986 CTCTTTGAAGGAATTGTGAATGG + Intronic
931768223 2:65475641-65475663 CTTATTAAAGAGACTTTGGATGG - Intergenic
932148625 2:69347367-69347389 CTTTCTGATGGGATTGTGGTAGG - Intronic
932359768 2:71094436-71094458 TATTTTAAAGGGATTGTGTCTGG + Intergenic
932520618 2:72408106-72408128 CTCTTTAAAGCAATTGTGAATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933801959 2:85968176-85968198 CTCTTTGAAGTGATTGTGAATGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934887421 2:98037109-98037131 CTATTCAATGGGAGTGTGGAAGG - Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG + Intergenic
935857945 2:107295578-107295600 CTTTTTGAAGCAATTGTGAATGG + Intergenic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
936848615 2:116869060-116869082 CTTTTTGTAGTGATTGTGAATGG + Intergenic
936911046 2:117594142-117594164 CTTTTTGAAGCAATTGTGAATGG + Intergenic
937634853 2:124144033-124144055 CTCTTTAAAGCAATTGTGAATGG - Intronic
937700516 2:124858444-124858466 CTCTTTGAAGCAATTGTGGATGG - Intronic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
939661726 2:144899347-144899369 CTTTTTGAAGCAATTGTGAATGG + Intergenic
939744097 2:145947932-145947954 CTCTTTGAAGTGATTGTGAATGG + Intergenic
939890577 2:147731257-147731279 CTCTTTGAAGCGATTGTGAATGG - Intergenic
940171943 2:150838201-150838223 CTTTTTAATGGGATTGTTTGGGG + Intergenic
940522527 2:154768936-154768958 CTTTTTGAAGTAATTGTGAATGG + Intronic
941318699 2:164027674-164027696 ATTTTTAAAGTGAATGTGAAAGG + Intergenic
941356683 2:164502491-164502513 CTTTTTAAATGTATTGTTGCAGG - Intronic
941510933 2:166408338-166408360 GCTTTTAAATGGATTGTTGATGG - Intronic
941665141 2:168237195-168237217 CTCTTTGAAGCAATTGTGGATGG + Intronic
941890395 2:170574939-170574961 ATTATTAAAGGGAGTGGGGAGGG - Intronic
942336175 2:174888777-174888799 CTTTTTAGAGGGTTTCTTGAAGG + Intronic
942514591 2:176738448-176738470 CTGTTTAAAGGGACTGAGCAAGG + Intergenic
943078793 2:183231417-183231439 TATTTCAAAGGGATTTTGGAAGG + Intergenic
943834771 2:192505604-192505626 CTTTTTAAAATAATTGTGTAAGG - Intergenic
943970053 2:194393090-194393112 CTTTTTGAAGCAATTGTGAATGG - Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944094291 2:195949043-195949065 CTTTTTGTAGGAATTGTGAATGG + Intronic
944861006 2:203816015-203816037 CTTTTTAGAGGGAATGAGGTGGG + Intergenic
946961584 2:224991122-224991144 CTTCTTCAAGGGGTTGTGGTGGG + Intronic
947097883 2:226586910-226586932 CTTTTTAATGGGGTTGTGTGTGG + Intergenic
947216506 2:227754897-227754919 CTTTTTAAAGATATTCTGGCTGG - Intergenic
947269779 2:228321003-228321025 CTCTTTAATGGAATTGTGGTGGG - Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947320415 2:228911319-228911341 CATTTTACATGGATGGTGGAGGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948333221 2:237187669-237187691 CTCTTTGAAGCGATTGTGAATGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1168935529 20:1662030-1662052 CTTTTTGCAGGGGTTGTGCAGGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171766103 20:29280058-29280080 CTTTTTGAAGGATTTGTAGAGGG - Intergenic
1171910103 20:30943624-30943646 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1172269067 20:33642962-33642984 CTTTTGAAAGTGATTTTGCAGGG - Intronic
1173770835 20:45655824-45655846 CTTTTTGAAGCTATTGTGAATGG - Intronic
1173928265 20:46797216-46797238 TTTTTTAAAGGGACACTGGAAGG - Intergenic
1174656486 20:52176360-52176382 CATTTTAGAGAGATTGTGGTTGG - Intronic
1174694935 20:52547638-52547660 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1175108983 20:56632553-56632575 CTGCTTAAATGGATTGAGGATGG + Intronic
1176700787 21:10047452-10047474 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1176712372 21:10162994-10163016 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1177033832 21:16016481-16016503 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1177878532 21:26665309-26665331 CTCTTTGAAGAGATTGTGAATGG + Intergenic
1178780210 21:35595730-35595752 CTTTTAAAAGGAATTTTGGGGGG - Intronic
1180511347 22:16093732-16093754 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1181004358 22:20004114-20004136 CTTTTTAATGGTATTGTAAATGG - Intronic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182280125 22:29213681-29213703 CTTTTTGCAGGGGTTGGGGAAGG + Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183849868 22:40576510-40576532 CCTTTTAAAGGGATAATGCAAGG + Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1184539575 22:45111609-45111631 TTTTTTAAAGAGATTGTGTTTGG - Intergenic
1184910540 22:47530774-47530796 CTTTTTTAAGAGATTGTAAAAGG + Intergenic
949222886 3:1657187-1657209 CTCTTTGAAGGAATTGTGAATGG - Intergenic
949362682 3:3248081-3248103 CTTTTGAGAGGTATTATGGATGG - Intergenic
949424022 3:3896683-3896705 CTCTTTGAAGCAATTGTGGATGG + Intronic
949593423 3:5517498-5517520 CTTTTTGAAGCAATTGTGAATGG + Intergenic
949800115 3:7894567-7894589 CTTTTTGAAGCAATTGTGAATGG + Intergenic
949932941 3:9093717-9093739 CTTTGAAAAGAGATTTTGGATGG - Intronic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950603347 3:14056203-14056225 CTCTTTGAAGTGATTGTGAATGG - Intronic
950873094 3:16246062-16246084 CTTTTTCAAGAGATTATGGCTGG + Intergenic
950920332 3:16687689-16687711 CTTTTTAAAGGGTCTGTAGGAGG - Intergenic
951311302 3:21129267-21129289 CTTTTTATAGCAATTGTGAATGG - Intergenic
951402976 3:22257684-22257706 TATTTAAAAGGCATTGTGGAGGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952612709 3:35230186-35230208 CTTTTTGAAGCAATTGTGAATGG - Intergenic
952665764 3:35902118-35902140 CTCTTTGAAGCAATTGTGGATGG + Intergenic
953270999 3:41445114-41445136 CTTTTTGAAGCAATTGTGAATGG - Intronic
953432923 3:42854473-42854495 ATTTTGAAAGGGAGTGTGGGGGG + Intronic
953543966 3:43847931-43847953 CTCTTTAAAGCGATTGTGAATGG - Intergenic
954578215 3:51688514-51688536 CTTTTGAAAAAGATTCTGGACGG - Intronic
954820840 3:53326179-53326201 AATGTTAATGGGATTGTGGAAGG - Intronic
954828331 3:53395522-53395544 CTCTTTGAAGCGATTGTGAATGG - Intergenic
955072192 3:55581238-55581260 CTTTTTAAAGGAAGTGGCGATGG - Intronic
955147336 3:56332868-56332890 CTTTTCAATGGGGTTATGGAGGG + Intronic
957780420 3:84811513-84811535 CTCTTTGAAGGAATTGTGAATGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957822751 3:85399726-85399748 CTCTTTGAAGGAATTGTGAATGG + Intronic
957860819 3:85946170-85946192 CTTTTTGAAGCAATTGTGAATGG - Intronic
958966784 3:100567750-100567772 CTTTTTAATGCTATTGTAGATGG + Intronic
958971790 3:100618967-100618989 CTTTTTAAAGCAATTGTGAATGG + Intronic
959111456 3:102127819-102127841 CTCTTTGAAGCGATTGTGCATGG - Intronic
959186921 3:103056585-103056607 CTTCTTCCAGGGACTGTGGACGG + Intergenic
959233233 3:103684693-103684715 CTTTTTAAAGCTATTGTGCTGGG - Intergenic
959701171 3:109300490-109300512 CATTTTAAAGGGATTGGTAAGGG - Intronic
959863467 3:111241399-111241421 CTTTTTGAAGCAATTGTGAATGG + Intronic
959880816 3:111442893-111442915 CTTTTTATAGTAATTGTGAATGG + Intronic
960363850 3:116747231-116747253 CTTTTTGAAGCAATTGTGAATGG - Intronic
960744357 3:120870251-120870273 TTTTTTAATGGGCTTGTGGCAGG - Intergenic
960945788 3:122965649-122965671 CTGTTTAAAGTTATTGTAGATGG + Intronic
961061533 3:123832919-123832941 ATTTATTAAGGGATTGTGTAAGG - Intronic
961127957 3:124438178-124438200 CATTTTGAAGGGAGTTTGGAGGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
962123068 3:132584735-132584757 CTCTTTGAAGGAATTGTGAATGG - Intronic
962301281 3:134245345-134245367 CATTTTAGAGGAATTTTGGAAGG - Intronic
962504471 3:136032053-136032075 ATTTTTATAGGAATTGTGGTGGG + Intronic
962893586 3:139694016-139694038 CTTTCTATTTGGATTGTGGAAGG + Intergenic
963459377 3:145588827-145588849 CTTTTTAAATAGTTTGTTGAGGG - Intergenic
963497009 3:146077563-146077585 CTTTTTAAAGGGAGAGAAGAGGG - Intronic
963789777 3:149572205-149572227 CTTTTTGCAGGGGTTTTGGAAGG + Intronic
964294768 3:155221367-155221389 CTCTTTATAGGAATTGTGAATGG + Intergenic
965015147 3:163148226-163148248 CTTTTTGAAGCAATTGTGAATGG + Intergenic
965623503 3:170664119-170664141 CTCTTTGAAGGAATTGTGAATGG + Intronic
965651133 3:170934678-170934700 CTTTTTGAAGCAATTGTGAATGG + Intergenic
966536648 3:181042501-181042523 CTCTTTAAAGCAATTGTGAATGG + Intergenic
967003157 3:185356385-185356407 TTTTTTAAAGGGAGTAAGGAGGG + Intronic
967639021 3:191838894-191838916 CTTTTTGTAGCAATTGTGGATGG - Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969352863 4:6608212-6608234 CTTTTTAAAAGGATCGTGCGGGG + Intronic
969501737 4:7557636-7557658 CTTTTTAAAGGCACTGGAGATGG - Intronic
971957977 4:33447277-33447299 CTTTTAAAAGGGATTTTGATTGG - Intergenic
972219966 4:36943614-36943636 CTCTTTAAATGGATGTTGGAAGG + Intergenic
972976128 4:44638531-44638553 CTTTTTAATGGGATTGTTTCAGG + Intronic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
974177937 4:58347896-58347918 CATTTTGTAGGGATAGTGGAGGG - Intergenic
974253843 4:59424026-59424048 CTCTTTAAAGCAATTGTGAATGG - Intergenic
974288182 4:59896355-59896377 CTCTTTAAAGCAATTGTGAATGG - Intergenic
974299720 4:60047801-60047823 CTCTTTAAAGCAATTGTGAATGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974518184 4:62943648-62943670 CTTTTTGTAGTGATTGTGAATGG + Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
974825755 4:67127535-67127557 CATTTTAATGGGATTTTGGGAGG - Intergenic
975007101 4:69303749-69303771 CTCTTTGAAGTGATTGTGAATGG - Intronic
975007812 4:69312345-69312367 CTCTTTGAAGCGATTGTGAATGG + Intronic
975036938 4:69695849-69695871 CTCTTTAAAGCAATTGTGAATGG + Intergenic
975703306 4:77087485-77087507 CTCTTTAAAGCAATTGTGAATGG - Intergenic
975729469 4:77323389-77323411 CTCTTTGAAGGAATTGTGAATGG + Intronic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977428457 4:96900887-96900909 CTCTTTGAAGCGATTGTGAATGG + Intergenic
978088746 4:104688636-104688658 CTTTTTGAAGCAATTGTGAATGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978769485 4:112439505-112439527 CTTGTTAAAGGGATTATGCAAGG - Intronic
979235679 4:118397610-118397632 CTTCTTAAAGGAATTGTGTTAGG + Intergenic
979235890 4:118399707-118399729 CATCTTAAAGGGATTGTGTTGGG + Intergenic
979508198 4:121522020-121522042 CTCTTTGAAGGAATTGTGAATGG - Intergenic
979576384 4:122296308-122296330 CTCTTTGAAGTGATTGTGAATGG - Intronic
979987398 4:127331935-127331957 CTTTTTAAAGGGGTTGACAAAGG - Intergenic
981708529 4:147686122-147686144 CTTTTTGAAGCAATTGTGAATGG - Intergenic
981884585 4:149658639-149658661 CTTATTAAAGAAATTGAGGAAGG - Intergenic
981964896 4:150588493-150588515 TTTTCTAAATGGAATGTGGATGG - Intronic
982638180 4:157923395-157923417 CTCTTTAAAGCAATTGTGAAGGG + Intergenic
982919512 4:161255510-161255532 CATTTTAAAGGGCCTATGGAAGG - Intergenic
983156518 4:164355005-164355027 CTTTTTGAAGCAATTGTGAATGG - Intronic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983612581 4:169665701-169665723 CTTTTTAAAAAAATTATGGAAGG - Intronic
983622888 4:169778314-169778336 CTCTTTGAAGCGATTGTGAATGG + Intergenic
984561579 4:181276866-181276888 CTTTTTAAAGAGACTGTTGGTGG + Intergenic
984863318 4:184258503-184258525 CTTTTTGGAGGGATTGTGCAGGG + Intergenic
985134143 4:186768319-186768341 CTCTTTGAAGCGATTGTGAATGG - Intergenic
985242932 4:187949994-187950016 CTCTTTATAGCGATTGTGAATGG + Intergenic
985243377 4:187954941-187954963 CTCTTTATAGCGATTGTGAATGG - Intergenic
985357950 4:189141330-189141352 CTCTTTGAAGCGATTGTGAATGG - Intergenic
985495453 5:202184-202206 CTTTTGAAATGGATTGTGGTCGG - Exonic
986244497 5:5993800-5993822 CTTTTTGTAGCTATTGTGGATGG + Intergenic
986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG + Intergenic
986947854 5:13046696-13046718 CTTATTTCAGGGACTGTGGAAGG + Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987351866 5:17029537-17029559 CTTTTTAATGGGATTGTTGGGGG - Intergenic
987775549 5:22361321-22361343 CTTTTTGAAGCAATTGTGAATGG - Intronic
987905802 5:24075388-24075410 CTTTTCAAAGGCATTATGGAGGG + Intronic
988044892 5:25938109-25938131 CTCTTTGAAGCGATTGTGAATGG + Intergenic
988667875 5:33349915-33349937 CTCTTTAAAGCAATTGTGAATGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989857507 5:46316603-46316625 CTCTTTGAAGGAATTGTGAATGG - Intergenic
990691887 5:58373330-58373352 CTTTTTGAAGCAATTGTGAATGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993621830 5:90177726-90177748 CTCTTTATAGTGATTGTGAATGG - Intergenic
994334739 5:98550928-98550950 CTCTTTGAAGCGATTGTGAATGG - Intergenic
994492030 5:100459847-100459869 CTTTTTGAAGCAATTGTGAATGG + Intergenic
994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG + Intergenic
994973430 5:106772733-106772755 CTTTTTGAAGCGATTGTGAATGG + Intergenic
995687337 5:114785028-114785050 CTATCTGAAGGGAGTGTGGATGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996966444 5:129311878-129311900 CTGTTTAAAGCAATTGTGAATGG - Intergenic
997017791 5:129957215-129957237 CTTTTTATAGCAATTGTGAATGG + Intronic
997095122 5:130901923-130901945 CTTTTTGAAGCAATTGTGAATGG - Intergenic
997762201 5:136460421-136460443 ATTTTTGAAGGCATTTTGGAAGG - Intergenic
998201074 5:140121867-140121889 CTGTTTAATGTGTTTGTGGATGG + Exonic
999092219 5:148946518-148946540 CTTTTTGAAGCAATTGTGAATGG - Intronic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1000384546 5:160662035-160662057 CTTTTTGAAGCAATTGTGAATGG - Intronic
1002647401 5:180666882-180666904 CTTGTTAAAGTGGTTTTGGAAGG + Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004695937 6:18033106-18033128 TTTTATAAATGGATTGTTGAGGG + Intergenic
1005041329 6:21602926-21602948 CTTTTAACAAGGATGGTGGAAGG - Intergenic
1006345868 6:33481927-33481949 ATTTTTAAATGTTTTGTGGAAGG - Intergenic
1006886282 6:37384764-37384786 CCTTTTAAAGGGATGTTTGAAGG + Intronic
1007815767 6:44524578-44524600 ATTTTGATAGGGATTGTGAAAGG + Intergenic
1008173668 6:48239714-48239736 CTTTTTAATGGGATTGTTAATGG - Intergenic
1009613412 6:65975376-65975398 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1009686031 6:66958905-66958927 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1009795641 6:68463301-68463323 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1010289656 6:74120626-74120648 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1010476541 6:76295290-76295312 CTTTTTGAAGTAATTGTGAATGG + Intergenic
1011397529 6:86925547-86925569 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1011569134 6:88715206-88715228 CTTTTTGAAGCAATTGTGAATGG - Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012204238 6:96440993-96441015 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG + Intergenic
1013735368 6:113221126-113221148 TTTTTTAAAGTGACTATGGATGG - Intergenic
1013868037 6:114722475-114722497 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1013873979 6:114801660-114801682 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1013940621 6:115657093-115657115 CTTTTTGATGGGATTGTGTGTGG + Intergenic
1014134699 6:117874970-117874992 CTTTTTGAAGTGATTGTGAATGG + Intergenic
1014499845 6:122172813-122172835 ATTTTTGATGGTATTGTGGATGG - Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1014777661 6:125529091-125529113 CTTTTTAAAAGAAATGTGGTGGG + Intergenic
1014988719 6:128047257-128047279 ATTTTTAGAGGGAGTGAGGAAGG + Intronic
1015265923 6:131292465-131292487 CTTCTCAAAGGGACTGAGGAAGG - Intergenic
1015930815 6:138357704-138357726 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1016095229 6:140028882-140028904 CTTTTTATAGCAATTGTGAATGG + Intergenic
1016588618 6:145717859-145717881 CTCTTTGAAGGAATTGTGAATGG - Intronic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017854196 6:158334820-158334842 CTTATAAAAGGGCTTGAGGAAGG + Intronic
1018312736 6:162527720-162527742 ATTTTTAAAAGGAGTGAGGAGGG + Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019855587 7:3603432-3603454 CTCTTTGAAGGAATTGTGAATGG + Intronic
1020922577 7:14283254-14283276 CTCTTTAAAGCAATTGTGAATGG - Intronic
1020950091 7:14664544-14664566 TTTTTTAAAGGGCATGTGTAAGG - Intronic
1021111684 7:16701929-16701951 CTTGTTAAAGGTAATTTGGAGGG + Intronic
1021725611 7:23545325-23545347 CTTTTTTAAGGATTTGGGGAGGG - Intergenic
1021895781 7:25234358-25234380 TTTTTTAAAGCAATTGTGTAAGG + Intergenic
1021957100 7:25836472-25836494 GTTTTTAAAGAGATTGTCCAAGG - Intergenic
1023419423 7:39963374-39963396 CTCTTTAAAGCAATTGTGAATGG + Intronic
1023977952 7:45045878-45045900 ATTTTTTAAGTGATTGTGAATGG - Intronic
1024110572 7:46142203-46142225 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1024260024 7:47567377-47567399 CGTCTTAAAGTGATTGTGAATGG - Intronic
1024408732 7:49014170-49014192 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1025534908 7:61935591-61935613 CTTTTTAAAGGATCTGTGAAGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026958985 7:74396823-74396845 CTTTTTAAAGTTGTTGTGGGGGG - Intronic
1027141123 7:75658399-75658421 TTTTTTGAAGGAATTCTGGAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027276527 7:76562946-76562968 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1027388516 7:77682047-77682069 CTTTTTAAAGCCATTGTGGTGGG - Intergenic
1027591519 7:80124898-80124920 CTTCTTAAAGAGTTTGTGTAGGG - Intergenic
1028155750 7:87427473-87427495 CTTTTTAATGGGAATGGGGGTGG + Intronic
1028521301 7:91734153-91734175 CTTTTTGAAGCAATTGTGAATGG - Intronic
1028620626 7:92823645-92823667 CTTTTTAAAGTGATTCTACATGG + Intronic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1029932884 7:104391935-104391957 CTTTTTGAAGCAATTGTGAATGG + Intronic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1030587495 7:111438802-111438824 CTTTTTTAAGAGATTGTGTTAGG - Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031247836 7:119339880-119339902 CTTTTTATAGCAATTGTGAATGG - Intergenic
1032951795 7:136922887-136922909 CTTTACAAAGGGATCGTAGAAGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033914495 7:146307220-146307242 CTTTTTGAAGCAATTGTGAATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034383193 7:150716934-150716956 CTTTGTTAAGGGAATGTGGGAGG - Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035964786 8:4178818-4178840 CTCTTTGAAGGAATTGTGAATGG - Intronic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1036072985 8:5462595-5462617 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036498575 8:9293306-9293328 CTATCTAAAGGGATTGTTGAGGG + Intergenic
1037133076 8:15429725-15429747 CTCTTTGAAGGAATTGTGAATGG + Intronic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1039158373 8:34588800-34588822 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1039435570 8:37557184-37557206 AGTTTTAAAGGGATTGGGGGGGG - Intergenic
1040010930 8:42660487-42660509 CTTTTAAATGTGTTTGTGGAAGG - Intergenic
1040128369 8:43764990-43765012 CTTTTTAAAGGATCTGTGAAGGG + Intergenic
1040140119 8:43899809-43899831 CTTTTCAAAGGAACTGTGAAGGG + Intergenic
1040368172 8:46741637-46741659 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1040437286 8:47403593-47403615 CTTTTTGAAGCAATTGTGAATGG - Intronic
1040873484 8:52125262-52125284 ATTTTTATAGAGATTCTGGAAGG - Intronic
1041293897 8:56334510-56334532 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1041387820 8:57322699-57322721 CTGTTTAAAGAAATTGTGAATGG + Intergenic
1041459279 8:58093998-58094020 CTCTTTATAGCGATTGTGAATGG + Intronic
1041842656 8:62289992-62290014 CTCTTTGAAGTGATTGTGAATGG + Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042363315 8:67907527-67907549 CTTTTTAATGGTATTATGAAAGG - Intergenic
1042458796 8:69037891-69037913 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1043462452 8:80474079-80474101 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1044882653 8:96740212-96740234 CTTTTTAAAGCAATTGTGAATGG + Intronic
1044883746 8:96752379-96752401 CTTTTTGTAGGAATTGTGAATGG + Intronic
1044909407 8:97041234-97041256 CTCTTTAAAGCAATTGTGAATGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045587203 8:103551842-103551864 CTCTTTGAAGCAATTGTGGATGG - Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045904038 8:107321453-107321475 CCTTTTAAAGGGAATGGGGTAGG - Intronic
1046251253 8:111634495-111634517 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1046370714 8:113303152-113303174 CTCTTTGAAGCAATTGTGGATGG - Intronic
1046378906 8:113427377-113427399 CTTTTTGAAGTAATTGTGTAAGG - Intronic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1046683291 8:117195802-117195824 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1046895531 8:119467892-119467914 ATTTTTGAAGTGATTGTGAATGG - Intergenic
1047077694 8:121422269-121422291 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1047559676 8:125973093-125973115 CATTTTAAAGGGCTTGAGGGAGG - Intergenic
1047804783 8:128347903-128347925 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1048647630 8:136439826-136439848 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1048827760 8:138446045-138446067 CTCTTTGAAGCGATTGTGAATGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050091404 9:2018171-2018193 ATTTTTTAAGGGAATGAGGAAGG + Intronic
1050969479 9:11851068-11851090 TTATTTAAAGTAATTGTGGAAGG - Intergenic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051673671 9:19537953-19537975 CTTTTTGAAGCAATTGTGAATGG + Intronic
1051905632 9:22091577-22091599 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1052384995 9:27812120-27812142 CTCTTTATAGCAATTGTGGATGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053935401 9:43144847-43144869 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055237427 9:74141110-74141132 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1055280963 9:74674257-74674279 TGTTTTAGAGGTATTGTGGAAGG - Intronic
1055374141 9:75630891-75630913 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1056978472 9:91283703-91283725 CTCTTTGAAGGAATTGTGAATGG - Intronic
1057069448 9:92083991-92084013 CTCTTTGAAGGAATTGTGAATGG + Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058085595 9:100744906-100744928 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1059119045 9:111625429-111625451 CTTTTTAAAGACATTGTTGTTGG + Intergenic
1059675320 9:116533110-116533132 CTTTTTGAAGCAATTGTGAATGG + Intronic
1060647431 9:125292913-125292935 CTTTCAAAAGGAATTCTGGAGGG + Intronic
1062095363 9:134700347-134700369 CTTTACAAAGGGATAATGGAGGG - Intronic
1202785798 9_KI270719v1_random:17510-17532 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1202797120 9_KI270719v1_random:131984-132006 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1203444058 Un_GL000219v1:38362-38384 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1203356429 Un_KI270442v1:152912-152934 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1203514866 Un_KI270741v1:157271-157293 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186475355 X:9853022-9853044 CTTCTCAGTGGGATTGTGGATGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187645627 X:21343953-21343975 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1187857121 X:23647655-23647677 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1188682073 X:33021955-33021977 CTTTTTAAAATTATTTTGGAAGG - Intronic
1188785791 X:34344825-34344847 CTCTTTGTAGGGATTGTGAATGG - Intergenic
1188811189 X:34656446-34656468 TTTTTTAACGGGGGTGTGGAAGG + Intronic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1190686615 X:52880044-52880066 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1190687052 X:52884322-52884344 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1190698930 X:52971470-52971492 CTCTTTGAAGCAATTGTGGATGG - Intronic
1191001999 X:55670080-55670102 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1191054860 X:56231573-56231595 CTCTTTAAAAGAATTGTGGTAGG + Intergenic
1191076291 X:56456951-56456973 CTCTTTAAAGAAATTGTGAATGG + Intergenic
1191124105 X:56935914-56935936 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1191595489 X:62938983-62939005 CTCTTTGAAGGAATTGTGAATGG + Intergenic
1191614161 X:63150389-63150411 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1191622135 X:63228538-63228560 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1191624524 X:63256090-63256112 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1191635472 X:63371428-63371450 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1192398879 X:70813840-70813862 CTCTTTGAAGGAATTGTGAATGG - Intronic
1192865190 X:75123569-75123591 ATTTTTATAGGGATTGTGTTGGG + Intronic
1192974791 X:76271662-76271684 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1193068967 X:77287223-77287245 CTTTTTATAGTAATTGTGAATGG - Intergenic
1193218508 X:78894559-78894581 CTTTTTACAGCTATTGTGAACGG + Intergenic
1193303914 X:79926658-79926680 CTCTTTGTAGGGATTGTGAATGG - Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1193392101 X:80940937-80940959 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194748349 X:97655038-97655060 CTTTTTAAAAGAAATGTGAATGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195017514 X:100793894-100793916 CTGTTTCAGGGGATTGTGCAGGG - Intergenic
1195261445 X:103135773-103135795 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195416031 X:104620341-104620363 TTTTTTAAAGAGATGGTGGCTGG + Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195675676 X:107505828-107505850 CTTTTTAAAGGATGAGTGGAAGG - Intergenic
1195794635 X:108631405-108631427 CTTTTTGAAGCAATTGTGAATGG + Intronic
1195825913 X:109000514-109000536 ATTTTTAAAGGGATTCTAGGTGG - Intergenic
1196279961 X:113812492-113812514 ATTTTTGAAGGGATCATGGAGGG - Intergenic
1196283268 X:113848994-113849016 CTTTTTAAAGGGGATGAGCATGG + Intergenic
1196756766 X:119164409-119164431 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1197432862 X:126387525-126387547 CTCTTTGAAGGAATTGTGAATGG - Intergenic
1197447058 X:126563423-126563445 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1197448311 X:126579925-126579947 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1197532934 X:127653014-127653036 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG + Intronic
1197930152 X:131686408-131686430 TCTTTTAAAGAGATTGCGGAGGG + Intergenic
1198166059 X:134058391-134058413 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1198863061 X:141091401-141091423 ATCTTTAAAGGAATTGTGTAGGG - Intergenic
1198899629 X:141495986-141496008 ATCTTTAAAGGAATTGTGTAGGG + Intergenic
1199029574 X:142980982-142981004 ATCTTTAAAGGGAAAGTGGATGG - Intergenic
1199378053 X:147135676-147135698 CTTTTTGTAGGAATTGTGAATGG - Intergenic
1199411886 X:147533918-147533940 CTTATAAAAGGGGCTGTGGAAGG - Intergenic
1199564007 X:149195294-149195316 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1199578535 X:149338254-149338276 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1199588334 X:149440065-149440087 CTTTTTGAAGCAATTGTGAATGG - Intergenic
1200322266 X:155202001-155202023 CTCTTTGAAGGAATTGTGAATGG - Intronic
1201314059 Y:12625768-12625790 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1201392769 Y:13516180-13516202 CTCTTTGAAGTGATTGTGAATGG + Intergenic
1201425626 Y:13847672-13847694 CTTTTTGAAGCAATTGTGAATGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
1202087859 Y:21157592-21157614 CTTTTTGAAGCAATTGTGAATGG + Intergenic