ID: 1099739499

View in Genome Browser
Species Human (GRCh38)
Location 12:86614409-86614431
Sequence CAGAATAATTAAAGGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099739493_1099739499 10 Left 1099739493 12:86614376-86614398 CCTCTGACGATGCAGTGAGTGTG 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG 0: 1
1: 0
2: 1
3: 22
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099739499 Original CRISPR CAGAATAATTAAAGGGATTA TGG Intronic
903005763 1:20297590-20297612 CAGAATACTTATAGGAAATAGGG + Intronic
906259900 1:44378972-44378994 CATCAGAATTAAAGGGCTTAAGG + Intergenic
906431592 1:45759946-45759968 TATGATAATTAAAGGGATTTGGG - Intergenic
906587006 1:46987160-46987182 CAAAATAAATAAAGGGATGGAGG + Intergenic
906676951 1:47700230-47700252 GAGAATAATTAATGGAATGATGG + Intergenic
907145011 1:52223722-52223744 CATGATAATTAAAGGGATTTGGG - Intronic
910058088 1:83055788-83055810 AAGAAAAATAAAAGGGAGTAAGG - Intergenic
910362583 1:86428929-86428951 CAGAAAAATTAAAGGCATATAGG + Intronic
911753092 1:101521317-101521339 GAAAATATTTAAAGGGATTAAGG - Intergenic
912145842 1:106793233-106793255 CAGAATAATTAAATAAATTATGG + Intergenic
912913191 1:113784046-113784068 TAGAACATTTAAAGTGATTAGGG + Intronic
913119990 1:115731091-115731113 CAGAATATTTAAAGAGACAAAGG - Intronic
915851945 1:159333523-159333545 GAAAATCATGAAAGGGATTATGG - Intergenic
917046113 1:170862272-170862294 AAGAATTAATAAAGAGATTATGG + Intergenic
917785373 1:178450398-178450420 CAGAAAAATTAAAGGCATTGAGG - Intronic
918464088 1:184804306-184804328 AAGAATAGTTAAAGAGATGAAGG + Intronic
918602733 1:186382522-186382544 CAGAATAACAAAGGGGATTTGGG - Intronic
918861797 1:189837376-189837398 CAGTATAATTAAAGGCATGGAGG - Intergenic
918988818 1:191670266-191670288 CAGCATAATTAATGGGACAATGG + Intergenic
920961042 1:210664431-210664453 CTGAATAATTAATGAGATAATGG + Intronic
922050674 1:221987565-221987587 AAGAATAATTTTAGGGAATAAGG + Intergenic
923642544 1:235779337-235779359 CAGGAAAAATAAAAGGATTAGGG + Intronic
923657444 1:235930322-235930344 CAGAATAATGCCAGGGACTATGG - Intergenic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1065184504 10:23158822-23158844 TAGAATAATTAAAGAGATCTTGG + Intergenic
1066079457 10:31915830-31915852 AAAAATAATTAAAATGATTATGG + Intronic
1066332104 10:34435013-34435035 CAAAATAAATAAAGGTATCAGGG + Intronic
1067536435 10:47113959-47113981 GAGAACAATTAAAGGGTTTGAGG + Intergenic
1067692900 10:48514237-48514259 AAGAATATTTAAAGGAATGATGG + Intronic
1067757526 10:49016238-49016260 CAGAGTAATTAGAGAGTTTATGG + Exonic
1068471273 10:57466861-57466883 AAGAATAATTAAATGTATTTAGG - Intergenic
1068839981 10:61601099-61601121 GATAAGAGTTAAAGGGATTATGG + Intergenic
1068914587 10:62415340-62415362 CTGATTATTTAAAGTGATTAGGG + Intronic
1069323728 10:67205184-67205206 CAGAATAATTAAGGGCAGTTTGG + Intronic
1069408177 10:68124493-68124515 CATATTAATTCAAGGGATTCTGG + Intronic
1070055746 10:72932977-72932999 CAGACTAATTATAGGGAATTTGG + Exonic
1071225529 10:83524180-83524202 CAGGATAATTATAGGGGTTGAGG - Intergenic
1073137163 10:101226453-101226475 CAAAATAATTATAGGGCTTTGGG + Exonic
1074633023 10:115280027-115280049 CTTGACAATTAAAGGGATTAGGG + Intronic
1074797921 10:116967831-116967853 AAGAATAATTAAATACATTATGG + Intronic
1074841584 10:117357963-117357985 CAAAATAATCTATGGGATTAAGG + Intronic
1076622115 10:131796905-131796927 CAGAATAACTAAATGAATTAAGG - Intergenic
1076897937 10:133323310-133323332 CAGCAACACTAAAGGGATTAGGG + Intronic
1077650183 11:3964424-3964446 GAGAAGGATTAAAGGGATTGAGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079399366 11:20093338-20093360 CAGAATGCTGCAAGGGATTATGG - Intronic
1081354603 11:42096745-42096767 CCAAATAATTATAGAGATTAGGG + Intergenic
1085342836 11:75744619-75744641 CAGAATGATAAAAGGGAATCTGG - Intergenic
1085830112 11:79891074-79891096 CAGAAGAAAGAAAGGGATTTAGG - Intergenic
1087543898 11:99559305-99559327 CTGAATAAATAAAGGAAATATGG - Intronic
1087807638 11:102572297-102572319 CAGAATAACTAAAGGGAGGGAGG - Intergenic
1087890967 11:103537524-103537546 CAGAAAAAAAAAAGGGATAATGG + Intergenic
1089237618 11:117045510-117045532 CAGAATATTAAAATGGCTTATGG - Intronic
1090150813 11:124381874-124381896 CAGAATAATAAAAGGCAAAATGG + Intergenic
1090152104 11:124395884-124395906 CAGAATAATAAAAGGCAAAATGG + Intergenic
1090162702 11:124511904-124511926 CAGATTAATTATAAAGATTATGG + Intergenic
1090743997 11:129692316-129692338 CATAATAAATAAAGAGATAAAGG - Intergenic
1093096002 12:14973119-14973141 CAGGATAATTGAAGGGCTTTGGG + Intronic
1094226864 12:28055767-28055789 GAGAATAATTCAAGGTATCATGG + Intergenic
1094235385 12:28159652-28159674 CAGAAATATTAAGGGCATTATGG - Intronic
1095030780 12:37274179-37274201 CTGGATATTTAAAGGGCTTATGG + Intergenic
1095133233 12:38567846-38567868 CACCATTATGAAAGGGATTAAGG + Intergenic
1095180012 12:39136538-39136560 TAGACTTATTGAAGGGATTAAGG - Intergenic
1095520241 12:43055304-43055326 GAGAATAATTTAAGGAATTTGGG + Intergenic
1096302074 12:50438492-50438514 CAAAAAAAAAAAAGGGATTAAGG + Intronic
1098170896 12:67746136-67746158 CAGAATCATATAAGGGACTAAGG - Intergenic
1098559859 12:71860091-71860113 CAGACCAATTAAAGAGAATAAGG - Intronic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1099805195 12:87509719-87509741 CAGAAAAATTATAAAGATTAAGG + Intergenic
1104208818 12:126667149-126667171 CAAAATAAATAAAGGAAATATGG + Intergenic
1106704099 13:32262062-32262084 CAGAATCATAAAAGGTATTTGGG - Intronic
1107412872 13:40173491-40173513 AACAATAATTAAAGGGTTTTGGG - Intergenic
1107510842 13:41082414-41082436 CAGTACAAGTAAAGGGATAAGGG - Intronic
1108616850 13:52141665-52141687 CAGAATAATGAAATGGAACAGGG - Intronic
1108979805 13:56496437-56496459 AAGTAAAATTAAAGTGATTAAGG - Intergenic
1109710696 13:66155409-66155431 AAGAATATTTAAAGAGATCAAGG + Intergenic
1109725713 13:66338789-66338811 CAGAAAAATTAAAGTCATAAAGG - Intronic
1109927308 13:69160818-69160840 CTGAATAAATAACGAGATTAAGG + Intergenic
1111230145 13:85334696-85334718 GAGAATAATTAAAGGAATCCTGG - Intergenic
1111389209 13:87569522-87569544 TAGAAGAATTAAAGGAATTATGG + Intergenic
1111806597 13:93045843-93045865 CAGAATAAAGAATGGGATGAGGG + Intergenic
1114253554 14:20982237-20982259 CTTAATAATTTAAGGAATTAAGG + Intergenic
1115300702 14:31882053-31882075 CACAATAAGTTAAGGGAGTAAGG - Intergenic
1117968988 14:61233917-61233939 AAGAATAAATAAATGGGTTATGG - Intronic
1118087629 14:62436506-62436528 CACAATAATTAGAGGTAATAGGG - Intergenic
1118875700 14:69783200-69783222 GAGAATAAATAAAGGAATGAAGG - Intronic
1119010355 14:70979565-70979587 AAGCATAAATAAAGGGAATAGGG - Intronic
1119212220 14:72840649-72840671 CAGAACCATTAAAAGGATTTTGG - Intronic
1119309595 14:73634649-73634671 GAGACAAAATAAAGGGATTAAGG - Intergenic
1119612164 14:76072759-76072781 CAGAATCATTATAGAGATCAGGG + Intronic
1120719018 14:87870309-87870331 GAGAGTAATTAAAGGTATGAAGG + Intronic
1121365497 14:93305560-93305582 CAGAACAAGCAATGGGATTAAGG - Intronic
1125137589 15:36362165-36362187 GAAAATAATTAAAGGAATTTAGG - Intergenic
1125872170 15:43112060-43112082 CAGAATATTTAAAAGGCTCATGG - Intronic
1126962497 15:54013286-54013308 CAGAATCATTAAATGAACTAAGG + Exonic
1127795925 15:62438276-62438298 CAGAATGTTTAAAGGGAGTGGGG + Intronic
1129527936 15:76234213-76234235 CAGAACAAGTATAGGGATTTTGG + Intronic
1134126239 16:11618165-11618187 CAGAATAAATAAATGGGTTATGG - Intronic
1136415218 16:30098756-30098778 TATGATAATTAAAGGGATTCAGG + Intergenic
1138318345 16:56089681-56089703 AAGAATAAGTAAAGGAATGAAGG + Intergenic
1138739941 16:59296319-59296341 CTGGATAATGAAAGGGATTTAGG + Intergenic
1140498913 16:75415752-75415774 TAGAATGAATAAACGGATTATGG - Intronic
1148100482 17:45087487-45087509 CAGAATATCTAAAAGGATTCTGG + Intronic
1149065050 17:52469443-52469465 CAGAATAATTATGAGAATTATGG + Intergenic
1149301301 17:55306790-55306812 AAGAATAAAGAAAGGTATTATGG - Intronic
1150028168 17:61700714-61700736 AAGAATATTTAAAGAAATTATGG - Intronic
1150198424 17:63326358-63326380 AAGAATAAGCAAATGGATTAAGG + Intronic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1154062919 18:11080506-11080528 CAGAATGAATAAAGGAATAAAGG + Intronic
1156409378 18:36813009-36813031 CAAAATAATTACAGAGATAACGG + Intronic
1158525064 18:58206006-58206028 AAGAGAAATTAAAGGAATTAAGG - Intronic
1158843482 18:61414415-61414437 CAAAAGAACTAAAGGAATTAGGG + Intronic
1158915462 18:62122186-62122208 CAGAATAATTAAAAAGATCCTGG + Intronic
1159013308 18:63080158-63080180 CAGAACAATGAAAGAGATTGAGG - Intergenic
1159316524 18:66781510-66781532 CAGAATCATTAAAGGGGTGTAGG + Intergenic
1159409307 18:68050716-68050738 AAGAATAATAAAATGGATTTTGG - Intergenic
1159742312 18:72187537-72187559 CAGAATCAGTAATGAGATTATGG + Intergenic
1163136529 19:15315492-15315514 CAGAATCCTTAAGGGGATTGGGG + Intronic
1165903656 19:39180401-39180423 CAGAATAAATAAAAGGTTTCAGG + Intronic
925021967 2:577574-577596 CAGGATGATTAAAAGGATAAAGG - Intergenic
925071592 2:973151-973173 CGGATTAAATAAAGGGATAAAGG - Intronic
926687092 2:15706403-15706425 CAGACTTATTAAATAGATTACGG + Intronic
926855137 2:17247708-17247730 TGGATTAATTAAAGGGATAATGG + Intergenic
927311041 2:21631501-21631523 CAGGATGATTAAAGGCATTGGGG + Intergenic
929332651 2:40702359-40702381 CAGAAAAGTTAAAGTAATTAAGG + Intergenic
929349749 2:40935835-40935857 CACAACAATTAAAGAGATTTTGG + Intergenic
931508559 2:62961211-62961233 TAGAAAAATTAAAAGGTTTATGG - Intronic
932273976 2:70437471-70437493 CAGAAAAATTAAAGGTAAAAAGG - Intergenic
932981203 2:76669562-76669584 CAGAATTATTACATTGATTACGG - Intergenic
933096740 2:78192932-78192954 AAGAATATTTAAAGAGATGATGG + Intergenic
933569033 2:83987058-83987080 CATAATAACTAAAGAGATGAGGG - Intergenic
935371540 2:102352011-102352033 CAGGAATATTAAAGGGATTCAGG + Exonic
936404468 2:112189885-112189907 CTGAATATTTAAAGGTATTAAGG - Intergenic
936600292 2:113889255-113889277 CAGGATAATAGAAAGGATTAAGG - Intergenic
937548521 2:123056525-123056547 ACAAATAATTAAAGGGAATAAGG - Intergenic
937666436 2:124493244-124493266 CAAATCAATTAAAGGAATTAAGG - Intronic
939622693 2:144439466-144439488 CAGAATAATTAGAGTTAATATGG + Intronic
940541966 2:155031546-155031568 CATAATAAATAAAGATATTAAGG + Intergenic
940843874 2:158618460-158618482 CATAATATTTAAAAGGAATATGG + Intronic
943587059 2:189753443-189753465 AAGCACAATTAAAGGGATTTTGG + Intronic
944101690 2:196034747-196034769 CAAGGTAATTCAAGGGATTAGGG + Intronic
945512184 2:210716370-210716392 CAAAATAATGAAAGGCCTTATGG - Intergenic
948170285 2:235895987-235896009 CAGTATACTTAAAATGATTAAGG - Intronic
1169052125 20:2588602-2588624 AACAGTATTTAAAGGGATTATGG - Intronic
1169323850 20:4658957-4658979 CATCATATTTAAAGTGATTATGG - Intergenic
1169707412 20:8521336-8521358 AAGAATAAGTAAAGGTATTGAGG + Intronic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1170877115 20:20260505-20260527 AAGAAAAACTAATGGGATTATGG - Intronic
1174815065 20:53680271-53680293 CAGAAGAAATGATGGGATTAGGG + Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1177709533 21:24754152-24754174 CAGATTAATTAAAGAGAATGTGG + Intergenic
1177868132 21:26537350-26537372 CAGAACACATAAAGGGATGATGG + Intronic
1179391054 21:40991593-40991615 CAGAATATTTAAAGAGATTCTGG + Intergenic
1179403632 21:41107808-41107830 CAGACTAAGTATAGGGAGTAGGG - Intergenic
1181851211 22:25751239-25751261 CAGAAAAAATACAGGGATTTAGG + Intronic
1181936032 22:26439436-26439458 CAGAGGAATTAAAGTGATTGTGG - Intronic
1182028011 22:27135568-27135590 GAGATTAATAAAAGTGATTAAGG + Intergenic
1182731772 22:32501699-32501721 AAAAATAATGAAAGGGATTGAGG + Intergenic
1183224664 22:36541341-36541363 CAGAAAAATTAAAGGGTTTATGG + Intergenic
1183770170 22:39917772-39917794 AAGAAAAATTAATGGCATTAGGG + Intronic
949332977 3:2942861-2942883 CAGAATACATCAAGGGACTAGGG + Intronic
949364752 3:3268855-3268877 CAGAGTAAATAAAGGGTATAGGG + Intergenic
949697873 3:6720258-6720280 CATAATAATTAAAGGTAATGTGG + Intergenic
951974680 3:28491984-28492006 CATATTAATTAAAGGGACAACGG + Intronic
952246783 3:31602748-31602770 AAGAATAATAAAATGGGTTAGGG + Intronic
952872790 3:37916804-37916826 CAGAACAAACAAGGGGATTATGG - Intronic
952984663 3:38768294-38768316 CACAATAAAAAAAGGAATTAAGG - Intronic
956093967 3:65696537-65696559 TAAAATAATTAAAATGATTAAGG + Intronic
956432905 3:69205507-69205529 AAGAAAAATTAAAGGGACTCAGG - Intronic
956648388 3:71479766-71479788 CAGAAAAATTATAAGGATTAAGG + Intronic
957752176 3:84435062-84435084 CAGAGTAATGAAAGGGCTCAGGG - Intergenic
957951018 3:87126541-87126563 GAGTATAATTAAAGGAACTATGG - Intergenic
959730838 3:109600146-109600168 CATAATAATTAAAGAAATTGAGG - Intergenic
962975615 3:140443260-140443282 CAGAATAATAAAAGGGAAAGAGG - Intronic
963131421 3:141861810-141861832 CAGAATTATGAGAGAGATTAGGG - Intergenic
963788095 3:149555862-149555884 CAGAATAATTTTAGTGATAAGGG + Intronic
964085005 3:152806558-152806580 CACAATTATTACTGGGATTAGGG - Intergenic
965238470 3:166160023-166160045 CATAATAATTTTAGGGTTTAAGG + Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
965719441 3:171645573-171645595 CAGAATTCTTAAAGGGCCTAGGG - Intronic
966090370 3:176128249-176128271 GAGAATGTTTAAAGGCATTATGG + Intergenic
967879248 3:194287613-194287635 CAGAAAAATTAACTGCATTATGG - Intergenic
968247032 3:197161927-197161949 CAGAATCATTAAAATTATTATGG - Intronic
969587368 4:8102154-8102176 CAGAATGACCAAGGGGATTAGGG - Intronic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971434636 4:26607111-26607133 CAGCATAACTAAATGGATGAAGG + Intronic
971470890 4:27025662-27025684 CAGAATACTTCAAAAGATTATGG - Intergenic
972086591 4:35224942-35224964 CAAAATAATTAAAGAGATTTTGG - Intergenic
972772693 4:42212598-42212620 GAGCATAATTCAAGGGGTTATGG + Intergenic
972886996 4:43504736-43504758 TAAAATAATTAAAGCTATTAAGG - Intergenic
974296152 4:60000927-60000949 CAGAAGAATTTAAGGAATGAGGG - Intergenic
974579925 4:63784068-63784090 TAGATATATTAAAGGGATTAGGG - Intergenic
974583294 4:63835494-63835516 CACAATAATAAAAGGTATTTAGG - Intergenic
977347736 4:95839294-95839316 CAGAATTATTAAACAGAGTAAGG + Intergenic
977440587 4:97062008-97062030 CAGATTAATTTAAGGAATGATGG - Intergenic
978133671 4:105231245-105231267 CAGAATATTTTGAGGAATTAAGG - Intronic
979456887 4:120936361-120936383 CAGAATAATTAAACATATTGTGG - Intergenic
982442655 4:155455056-155455078 CATAATAATTTTAGGGTTTAAGG + Intergenic
982515527 4:156343697-156343719 CCAAATAATTCAAGGAATTAAGG - Intergenic
982614897 4:157628422-157628444 CAGAATAACTAGAGGAATAACGG - Intergenic
983046318 4:162990620-162990642 AAGAATAATCAAAGGCACTAAGG - Intergenic
983388417 4:167097020-167097042 CAGAATAAATAAAATTATTAGGG - Intronic
983864972 4:172755146-172755168 CAGAATGATTCAAGGATTTAAGG + Intronic
984435881 4:179709595-179709617 AAGAATGATTAAGGTGATTAGGG + Intergenic
984550323 4:181151956-181151978 CAGCATACTTAAAGGAACTAAGG + Intergenic
985904135 5:2819861-2819883 CAGAAAAAAAAAAGCGATTAAGG - Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
986976384 5:13399289-13399311 CTGAATAATTAAATGAATTGAGG + Intergenic
987310908 5:16680183-16680205 TTGAATAATTAAAGGGACTGAGG - Intronic
987314608 5:16712445-16712467 CAGCTTAATTAAAGGGAACACGG - Intronic
987340918 5:16937877-16937899 CAGAACAATTACAGTCATTATGG + Intergenic
987921576 5:24289259-24289281 CAAAAATATTTAAGGGATTATGG + Intergenic
988016395 5:25565391-25565413 CATAAGAATTAAGGGGATTGTGG - Intergenic
988317727 5:29652378-29652400 CAGAATTTTAAAAGTGATTATGG + Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
991329243 5:65475404-65475426 CAGAATACAGAAAAGGATTAAGG + Intronic
992011019 5:72527619-72527641 TAGAATTCTTAAAGAGATTAAGG - Intergenic
993629703 5:90271034-90271056 CACAATAATTAAACATATTAAGG - Intergenic
994726026 5:103436608-103436630 CAATATAAGTAAAGGAATTATGG + Intergenic
995770730 5:115666072-115666094 CAGAAAAATTATCTGGATTATGG - Intergenic
995853493 5:116571572-116571594 CAAAATAATAACAGGGAGTAAGG + Intronic
996084297 5:119288459-119288481 CAGCACAATCAATGGGATTAAGG + Intronic
996644875 5:125801357-125801379 CATAGTAAATAAAGGGCTTAAGG - Intergenic
996757403 5:126949244-126949266 CAGGATAATTAAATCCATTAAGG - Intronic
998082020 5:139283639-139283661 CAGAAGACTCAAAGGGTTTATGG + Intronic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
999784696 5:154880481-154880503 TAGGATAATTAAAGGGATTCGGG + Intergenic
1000380557 5:160625366-160625388 GAGAGTGATAAAAGGGATTATGG + Intronic
1000493757 5:161951296-161951318 CAGAAACATTGAAAGGATTAAGG - Intergenic
1000683164 5:164212531-164212553 CAGGATAATTAATGGTAGTATGG - Intergenic
1004185926 6:13421096-13421118 TTGAATAATTAAAGAGAGTATGG + Intronic
1004928175 6:20435791-20435813 CACCATAATTAAAGGGATTCTGG + Intronic
1005574720 6:27180311-27180333 TATGATAATTAAAGGGATTCAGG + Intergenic
1005628712 6:27687482-27687504 CAAAACAATAATAGGGATTACGG - Intergenic
1007870454 6:45030701-45030723 TAGAATAATTATGGGGAGTAAGG + Intronic
1008136673 6:47785299-47785321 GAGAAAAATAAAAGAGATTACGG - Intronic
1009406646 6:63322005-63322027 TAAAATGATTAAAGGAATTATGG + Intergenic
1010130722 6:72490522-72490544 CAAAATAATTAAAAGAAATATGG + Intergenic
1012018873 6:93890390-93890412 CAGAATAATAAAAGAGATAAAGG - Intergenic
1012411444 6:98962623-98962645 CTGAATAATTGAATGAATTATGG - Intergenic
1012429251 6:99147057-99147079 CAAAATAATTAAAATTATTATGG - Intergenic
1012791799 6:103708356-103708378 AAGAATAATTAAAGAAATTGGGG + Intergenic
1014219423 6:118785365-118785387 AAGAAAAAATAAAGAGATTATGG + Intergenic
1015230309 6:130907658-130907680 CAGAATAAAAAAAGAGAGTAGGG + Intronic
1016273949 6:142325987-142326009 CAGAATAATTTTATGAATTATGG + Intronic
1016707579 6:147129473-147129495 CAAAATGATTAAATGAATTATGG + Intergenic
1017056480 6:150441039-150441061 GGAAATAATGAAAGGGATTATGG + Intergenic
1017260639 6:152382705-152382727 CAAAATAATTACAAGTATTAAGG - Intronic
1017952856 6:159151128-159151150 GAGAACAATTAGAGGGATTGGGG - Intergenic
1018226431 6:161633899-161633921 CAGACGAATTAAAATGATTATGG + Intronic
1018426104 6:163683302-163683324 CAGAATATTTGAAGAGATAATGG - Intergenic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1021236614 7:18149995-18150017 AAGAATTAGTAATGGGATTATGG - Intronic
1021517841 7:21506886-21506908 ACTAATAATTAAAGGGATCAAGG - Intronic
1022881389 7:34591672-34591694 CAAAAAAATTAATGGGACTAGGG + Intergenic
1023298137 7:38737987-38738009 CAGAAAAATAAAAGGGAGCAGGG - Intronic
1023368421 7:39488400-39488422 CACAATAATGCAAAGGATTATGG + Intronic
1024395743 7:48864752-48864774 GAAAAAAATTAAAGGGATTTGGG + Intergenic
1024399491 7:48907524-48907546 GAAAAAAATTAAAGGGATTTGGG - Intergenic
1024855312 7:53771717-53771739 CAGAAAACTTGAAGGGATAATGG + Intergenic
1028008014 7:85602852-85602874 TAGACTACATAAAGGGATTATGG + Intergenic
1029908849 7:104122169-104122191 AAGAAAAATGAAATGGATTACGG + Intergenic
1030350948 7:108485997-108486019 CAAAATAAGTTAAAGGATTACGG + Intronic
1030641300 7:112009774-112009796 GAGAAAAAGGAAAGGGATTAAGG + Intronic
1030856319 7:114562124-114562146 CAGAATAGTGAAAGTGTTTAAGG - Intronic
1031417280 7:121509289-121509311 TATGATAATTAAAGGGATTCAGG - Intergenic
1034189541 7:149203281-149203303 CAGAATAATGAAATGGTTTTGGG + Intronic
1034425643 7:151012711-151012733 TAGAATTTTCAAAGGGATTAGGG + Exonic
1034733650 7:153410202-153410224 TAGTATAATTAAAGGGGGTAGGG + Intergenic
1035099371 7:156383674-156383696 CAGAATGACTATAGAGATTATGG + Intergenic
1035937707 8:3860644-3860666 AATAATAATTAACCGGATTATGG - Intronic
1037601567 8:20400628-20400650 AAGAATAAGTAAAGGGAAGATGG - Intergenic
1039365104 8:36920917-36920939 AGGAATAATTTAAGGCATTAGGG + Intronic
1040132815 8:43817036-43817058 GATAATCATTGAAGGGATTAGGG + Intergenic
1042213842 8:66408960-66408982 CAAAATAAATAAAGAGATAAAGG + Intergenic
1043262732 8:78222120-78222142 TAGAAAAATTAAAAGGAATAGGG + Intergenic
1043823195 8:84893778-84893800 CAAAACATTTAAATGGATTAAGG + Intronic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044511313 8:93082859-93082881 CAGATTACTCAAAGGGATAATGG + Intergenic
1045567379 8:103334666-103334688 CAAAATTATTAGAGGGATTGAGG - Intergenic
1046752409 8:117939751-117939773 CAGAATAATGAAAGGAATAAAGG - Intronic
1047825597 8:128570937-128570959 CAGCATAAGTAAAGGCATCATGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048628332 8:136212167-136212189 CAGAATAATTAAAGAGTTGTTGG + Intergenic
1048869982 8:138789330-138789352 TACGATAATTAAAGGGTTTAAGG - Intronic
1049515880 8:143055128-143055150 CAGCACTATTAAAGGGAGTAGGG - Intronic
1049700189 8:144007359-144007381 CAGACTAATCAAAGGGATATTGG + Intronic
1049985232 9:944244-944266 CACAATAATTAAGGAGATCATGG - Intronic
1050752115 9:8951635-8951657 CAGAATAATTTAAAGGTTTCTGG - Intronic
1050818492 9:9846868-9846890 CAGGAGAATTAAAGAGAGTAGGG + Intronic
1051012523 9:12435726-12435748 AAGAGAAAATAAAGGGATTAGGG - Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1051706127 9:19881993-19882015 AAGAATAGTTAAATGAATTATGG - Intergenic
1052043148 9:23763915-23763937 GGGAATACTTAAAGGGATGAAGG + Intronic
1052153930 9:25157829-25157851 CAGAATAATTCCAGAGAGTAGGG + Intergenic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054859170 9:69931881-69931903 CACGATAATAAAAGGAATTAGGG - Intergenic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1055796125 9:79976627-79976649 CAGACTCATCAATGGGATTAGGG + Intergenic
1058290073 9:103229753-103229775 CAGAACTATTAAATAGATTAAGG + Intergenic
1058426814 9:104882569-104882591 CAGACTAATTGAAATGATTAGGG + Intronic
1061665434 9:132158256-132158278 CATAATAATTAATGGGAGTATGG + Intergenic
1186373757 X:8975263-8975285 CTGAATTATGATAGGGATTATGG - Intergenic
1186971479 X:14849697-14849719 CAAAATATTTAGAGGTATTAGGG - Intronic
1187728815 X:22232652-22232674 CAAAATAAATAAAGGGATGGAGG - Intronic
1193191540 X:78577097-78577119 CAAAATATTTGAATGGATTATGG + Intergenic
1193386145 X:80873570-80873592 CAGCCTGATTGAAGGGATTAAGG - Intergenic
1194178024 X:90676148-90676170 CAAAATGATTAAAGTGAATATGG + Intergenic
1197033546 X:121847979-121848001 CAAAAGGAATAAAGGGATTATGG - Intergenic
1197170089 X:123423326-123423348 CAGAATAATAAAAGACATGAAGG + Intronic
1198152698 X:133926734-133926756 CAGAAAAATTAAAGTGTTTGAGG + Intronic
1198998887 X:142608737-142608759 CCCAATAATGGAAGGGATTATGG - Intergenic
1199269456 X:145865545-145865567 AAGAATAATTAAAATGATGAGGG + Intergenic
1200524691 Y:4258305-4258327 CAAAATGATTAAAGTGAATATGG + Intergenic
1201898278 Y:19017490-19017512 CTTAATAATTAAAGGGAAAATGG + Intergenic
1201914901 Y:19171444-19171466 TATGATAATTAAAGGGATTTGGG + Intergenic