ID: 1099744602

View in Genome Browser
Species Human (GRCh38)
Location 12:86686374-86686396
Sequence TTGAATAGGAGTAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099744596_1099744602 10 Left 1099744596 12:86686341-86686363 CCTGATTGCCTGGGAAGAACTTC 0: 1
1: 0
2: 25
3: 72
4: 248
Right 1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG 0: 1
1: 0
2: 4
3: 58
4: 623
1099744597_1099744602 2 Left 1099744597 12:86686349-86686371 CCTGGGAAGAACTTCCAATACTA 0: 1
1: 39
2: 2157
3: 11157
4: 4151
Right 1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG 0: 1
1: 0
2: 4
3: 58
4: 623
1099744593_1099744602 29 Left 1099744593 12:86686322-86686344 CCTTTATTTCTTTCTCTTGCCTG 0: 2319
1: 4498
2: 6067
3: 6174
4: 3409
Right 1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG 0: 1
1: 0
2: 4
3: 58
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099744602 Original CRISPR TTGAATAGGAGTAAGGAAGA GGG Intronic
902554497 1:17238973-17238995 GTGAACAGGGATAAGGAAGAGGG - Intronic
902795943 1:18800378-18800400 CGGAACAGGAGGAAGGAAGAAGG - Intergenic
903369512 1:22826137-22826159 GTGAATTGGAGTGAGGAAGCAGG + Intronic
903565372 1:24261369-24261391 ATGAATAGGAATTAGGGAGATGG - Intergenic
904213890 1:28904465-28904487 TTCAATATAAGAAAGGAAGAAGG - Intronic
904896549 1:33822331-33822353 TTTCATAGAAGTAAGGAAGGTGG + Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905404579 1:37724219-37724241 TTGGATGGCAGAAAGGAAGAGGG + Intronic
905717513 1:40165239-40165261 CTGAATAGGAGTAAACAAGTTGG - Intronic
906443928 1:45876782-45876804 TTGTATAGGTGTAAGGAAGTCGG + Intronic
906792177 1:48668604-48668626 CTGAGTAGGAGTAAGCCAGACGG - Intronic
907141184 1:52186423-52186445 CTGAATAGGAGTAGTGAAAAAGG - Intronic
908398602 1:63749294-63749316 ATGAATAGGAGACAGGGAGATGG - Intergenic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
908870890 1:68610238-68610260 TTGAATAGGAGTGGTGAAGGTGG + Intergenic
909207747 1:72781051-72781073 CTAAATAGGAGCCAGGAAGACGG + Intergenic
909326520 1:74357782-74357804 TGGAATAGTAGAAACGAAGAAGG - Intronic
910001353 1:82346035-82346057 TTGAGTAGGAGCTAGGAAAAAGG + Intergenic
910135712 1:83966640-83966662 TAGAATAGAAGTAAGGAAATGGG + Intronic
910241859 1:85095334-85095356 ATGAATTGGGGAAAGGAAGAAGG - Intronic
910308076 1:85789588-85789610 TTGAATAGGAGTGAGGAGAGGGG + Intronic
910573386 1:88731066-88731088 TTGAATACCAGAAAGAAAGAAGG + Intronic
911468670 1:98287752-98287774 TTTAATAGGAATAAAGAAGTAGG + Intergenic
911646669 1:100344219-100344241 TTGAATAGGAGTTAGCTAGGGGG - Intergenic
911794855 1:102062656-102062678 TTGAATAGGAGTAATGAAAGAGG - Intergenic
912363174 1:109111725-109111747 TAGAATGTGAGTTAGGAAGAAGG - Intronic
912693790 1:111824783-111824805 TTAAGGAGGGGTAAGGAAGAGGG - Intronic
914227280 1:145731169-145731191 TGGAAAAGGATTGAGGAAGAAGG - Intronic
914924207 1:151869965-151869987 TTGAATAGCAGTAGTGAAGGTGG + Intergenic
915767386 1:158377136-158377158 TTGAATAGGAGTTGTGAAAATGG - Intergenic
915995769 1:160561616-160561638 TTGAATAGGAGTGATGAAAGAGG - Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916472944 1:165141631-165141653 TGGAATAGGAGGAAGGAGGGTGG - Intergenic
916718379 1:167463450-167463472 TTTAAAAGGAGAAAGGGAGAGGG + Intronic
916975205 1:170069772-170069794 TTGAATAGAAGTCAGGAAAGTGG - Intronic
917085621 1:171302956-171302978 TTGAATAGGAGTGGTGAAAATGG - Intergenic
917253717 1:173091286-173091308 TTGAATAGGAGTGGGAGAGAGGG - Intergenic
917254622 1:173100975-173100997 TTGATTGGGAGAAAGGAACAGGG + Intergenic
917303532 1:173603999-173604021 ATGGATAGGAGTTAGGAAAATGG - Intergenic
917568207 1:176233931-176233953 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
918053252 1:180993633-180993655 TTGAATAGGAGGAAAGAGAAAGG + Intronic
918441810 1:184575452-184575474 TTGCAGAGGGGTATGGAAGAGGG + Intronic
919215105 1:194543079-194543101 TTGAATAGGAGTGATGAAAGAGG + Intergenic
919659431 1:200229408-200229430 GTGTATAGTAGTAAGAAAGATGG - Intergenic
920325931 1:205163977-205163999 CTGAATAGTTGTGAGGAAGAAGG + Intronic
920943047 1:210501952-210501974 TGGAATAGGACTAAGGATGAGGG - Intronic
921125015 1:212169793-212169815 TTGATTGGGAGAGAGGAAGAAGG - Intergenic
921568569 1:216751044-216751066 TTGAATAGCAATGAGAAAGATGG - Intronic
922400027 1:225243884-225243906 TTAAATAGGAGTGGTGAAGAGGG + Intronic
922440257 1:225650212-225650234 TTGAATAAGAGCAGGAAAGAGGG - Intronic
923819616 1:237423771-237423793 TTCAATAGGGTTAAGGATGAAGG - Intronic
924572743 1:245252776-245252798 TTGAATAGAAGTAATGATGGTGG + Intronic
1062853362 10:763655-763677 TTGAATAGGAGTGATGAAAGTGG - Intergenic
1063298769 10:4833117-4833139 TTGAGGAGGAGTCAGGCAGAAGG + Intronic
1063556900 10:7089057-7089079 TGCAACAGGAGTAAGAAAGATGG + Intergenic
1063585738 10:7350487-7350509 TTTATTAGGAGGAAGCAAGATGG - Intronic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064639474 10:17400883-17400905 TTGAATAGGAGTGGTGAAGGAGG - Intronic
1064841567 10:19598096-19598118 ATGGATTGGAGTGAGGAAGAGGG + Intronic
1064848079 10:19678686-19678708 TTGAATAGGAGTGATGAAAGAGG + Intronic
1065291536 10:24235154-24235176 TAGACTTGGAGTAAGGCAGATGG - Intronic
1065308089 10:24387507-24387529 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1065407536 10:25386663-25386685 ATGATTAGGAGTAACCAAGAAGG - Intronic
1065691962 10:28343524-28343546 TTGAATAGGAGTGATAAAGCAGG + Intergenic
1066621358 10:37354621-37354643 ATGAATAGGAGTAGTGAAAATGG + Intronic
1066676404 10:37892019-37892041 AATAAAAGGAGTAAGGAAGAAGG + Intergenic
1067906838 10:50300388-50300410 TTGAATAAGAGTGAAGAAAATGG - Intergenic
1068339038 10:55677089-55677111 TCGAATAGGAGTAGTGAAAATGG + Intergenic
1068381432 10:56258693-56258715 TTGAATAGGAGTAGTGAGAATGG + Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069356606 10:67593796-67593818 TTGAATAGGAGTGATGAGGGTGG + Intronic
1070091626 10:73291565-73291587 TTGAAGAAGAGAAAGGAAAAAGG + Intronic
1070516291 10:77210517-77210539 TTGAATAGGAGTAATGAGAGCGG - Intronic
1070557682 10:77541645-77541667 TGAGATAGGAGTAAGGAAAATGG + Intronic
1070604370 10:77888474-77888496 ATGAATAGGATTAGGTAAGAAGG + Intronic
1071454075 10:85829404-85829426 TTGAATAGGAGTCATGATAATGG - Intronic
1071506384 10:86234193-86234215 TTAAATTGGAGGAAGGAAAAGGG - Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1072576109 10:96701662-96701684 ATAAATAGCAGTAAGGAAGGCGG + Intronic
1073638645 10:105226094-105226116 TTGAATAGGAGTGGTGAAAATGG + Intronic
1074757963 10:116641044-116641066 TTGAATAGGAGTAATGAGAGTGG + Intronic
1075489328 10:122853089-122853111 TTGAATAGGTGGAGAGAAGAAGG - Intronic
1077821382 11:5745150-5745172 TTGAATAGGAGTGGTGAACATGG - Intronic
1078447122 11:11412778-11412800 TGAGATAGGAGTAAGGAGGATGG - Intronic
1078521505 11:12067466-12067488 TTGAACAGGATTATGGGAGAGGG - Intergenic
1078533585 11:12156020-12156042 TTGAAAAGGAGTGGGGAAGAGGG + Intronic
1079848896 11:25504466-25504488 TTGAATAGGAGTGGTGAAAATGG + Intergenic
1079974161 11:27072025-27072047 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1080018861 11:27537448-27537470 TTGAATAGGAGTAATGAGAGAGG + Intergenic
1080193477 11:29579472-29579494 TTGACAAGGAATAAGGCAGAAGG - Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080616959 11:33952947-33952969 TTGAGTAGGAGGAAGGAAAGGGG - Intergenic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080796895 11:35572954-35572976 TTGAAAAGTACTGAGGAAGATGG - Intergenic
1081748757 11:45492247-45492269 CTGAATAACAGTAAGAAAGAAGG - Intergenic
1081824826 11:46039058-46039080 CTGAATAAAAGTAGGGAAGAAGG + Intronic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1082690961 11:56304111-56304133 TTGAATAGGAGTAACGAGAGTGG + Intergenic
1082915573 11:58431853-58431875 TTGAATTGGAGTGATGAAAATGG - Intergenic
1083077413 11:60055428-60055450 GTGACAAGGAGTAAGGAAGTAGG - Intergenic
1083132541 11:60638878-60638900 TTGAATAGGAGTAGTGAAAGTGG - Intergenic
1083522184 11:63324540-63324562 TTGAATAGGAGTGGTGAAAAAGG - Intronic
1084109429 11:67004091-67004113 TTGAGTATGAGTTAGGCAGATGG + Intergenic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1085536946 11:77227463-77227485 TTAAAGAGCAGTGAGGAAGAAGG - Intronic
1086411098 11:86545272-86545294 TTGAATAGGAGTGATGAAAGAGG - Intronic
1086740095 11:90356274-90356296 TTTAACAGGAGCAAGGAAGAGGG + Intergenic
1086748018 11:90454660-90454682 TTGAATAGGAGTTGGTGAGAGGG - Intergenic
1086977124 11:93146011-93146033 TTGAATTGCAGAAAAGAAGAGGG - Exonic
1087313837 11:96582795-96582817 TTGAATAGGAGTGGTGAAAATGG - Intergenic
1087423547 11:97963542-97963564 TTTAATAAGCGAAAGGAAGAAGG + Intergenic
1087440215 11:98174360-98174382 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1087525181 11:99300156-99300178 TTGAATAGGAGTGGTGAAAATGG + Intronic
1087725501 11:101711368-101711390 TTGAATAGGAGTGATGAAAGTGG - Intronic
1088013738 11:105034984-105035006 TTGAGTAGAAGCAAGGAAAAGGG - Intronic
1088564021 11:111148522-111148544 TGGAATAGCAATAAGGAAAAAGG + Intergenic
1088770759 11:113033678-113033700 TTTTATAAGAGTAAGGAAGCTGG - Intronic
1089296875 11:117474696-117474718 TTGATAAGGAGAAAGGGAGAAGG - Intronic
1089453352 11:118611389-118611411 TTGTAAAGGAGTAAGGCCGATGG - Intronic
1089514790 11:119025615-119025637 TTGGCTAGGGGTAAGGCAGAAGG + Intronic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090567466 11:128010565-128010587 TTGAATAGGAGTGGGGAGAAAGG - Intergenic
1090650791 11:128804188-128804210 TAGAATAAGAGTTGGGAAGACGG - Intronic
1091012447 11:132015955-132015977 TTGAATAGGAGTAGTGAAAGTGG + Intronic
1091048385 11:132346383-132346405 TTAAATAAGATTAAGTAAGAAGG - Intergenic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091737537 12:2935506-2935528 TTGAGTAAGAGAAAGCAAGAAGG + Intronic
1092320163 12:7463564-7463586 TTGAATAGGAGTGTGAGAGAGGG + Intronic
1093103882 12:15062086-15062108 TTGAATAGGAGTAGTGAAAGTGG + Intergenic
1093150362 12:15613573-15613595 TTGAATAGGAGTAGAGAAACTGG + Intergenic
1093260824 12:16935711-16935733 TTGAACAGGAGTGAGGAGCATGG + Intergenic
1093337564 12:17925340-17925362 TTGAATAGAAGTAGTGAAAATGG - Intergenic
1093693486 12:22134089-22134111 TTGAATAGGAGTGATGAGGGAGG - Intronic
1094043512 12:26142510-26142532 TTCAATAAGAATAAGGAATATGG + Intronic
1094313224 12:29109003-29109025 TTGAATAGGAGTGGGGAAAGTGG + Intergenic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1094424119 12:30301300-30301322 TTGAAATGCAGTTAGGAAGAAGG + Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095106134 12:38235093-38235115 TCGAAAATGAGTAAGGAAGATGG - Intergenic
1095342322 12:41106356-41106378 TGGAATTGGAGTGAGGGAGATGG - Intergenic
1095348115 12:41176619-41176641 TCGGATAGGAGAAAGGAACATGG + Intergenic
1095412544 12:41939572-41939594 TTGAATTGGAGGAATGAAAAGGG + Intergenic
1095512338 12:42966071-42966093 TTAAATAGCAGGAAGGGAGATGG + Intergenic
1096043020 12:48536707-48536729 TTGAATAGGAGTGGTGAAAATGG - Intergenic
1096762727 12:53856148-53856170 TTGACTAGTACTAAGGAAGCTGG + Intergenic
1096841760 12:54384294-54384316 TTAACTAGAATTAAGGAAGATGG + Intronic
1097347486 12:58510300-58510322 TTCAAAAGTAGTCAGGAAGAAGG - Intergenic
1097470493 12:59984982-59985004 TTGAATAGGAGTTATGAAAGAGG - Intergenic
1097514378 12:60586150-60586172 TTGAATAGGAGTGATGAAAGAGG - Intergenic
1097520840 12:60668876-60668898 TTGAATAGGAGTGATGAGAAAGG + Intergenic
1097761140 12:63465765-63465787 TTGAATAGGAGTAGTGAAAGAGG + Intergenic
1098003260 12:65968089-65968111 TTGAATAGAAGAAAGGGAGATGG - Intergenic
1098027067 12:66214921-66214943 TTGGATAGGAGTGGGGAAGAAGG + Intronic
1098092737 12:66921450-66921472 TTTAATAGAAGTAAAGAACAAGG - Intergenic
1098523861 12:71464294-71464316 TTGAATAAGAGGAAGAAAGGAGG + Intronic
1098834882 12:75411940-75411962 TTGAATTGGAGTGAAAAAGATGG - Intronic
1099029437 12:77506831-77506853 TGGAATGGGAGATAGGAAGAAGG - Intergenic
1099177433 12:79438091-79438113 TGGAATAGAAATAAGGAAGTAGG - Intronic
1099726748 12:86440581-86440603 TTGAATAGAAGTGATGAAAATGG - Intronic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1100115710 12:91301268-91301290 TTGTATAAGTGTAAGGAAGGGGG - Intergenic
1100145223 12:91669503-91669525 TTGAATAGGAGTCATGAAAGGGG + Intergenic
1102417722 12:112779121-112779143 TTGATTAGGAGAAAGGCTGATGG + Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1105955623 13:25279633-25279655 TTCAAATGGAGAAAGGAAGAAGG + Intronic
1106177355 13:27342643-27342665 CTGAAGTGGAGTAAGGAAAAGGG - Intergenic
1106239372 13:27898040-27898062 TGGAATATTAGGAAGGAAGAAGG - Intergenic
1106684326 13:32042160-32042182 ATGAAAAGAAGAAAGGAAGAAGG + Intronic
1106870593 13:34014642-34014664 TAGAGGAGGAGAAAGGAAGAAGG + Intergenic
1107218609 13:37952614-37952636 TTGAATAGGAGTGATGAAAGAGG + Intergenic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1108129609 13:47283739-47283761 TTGAATAGAAGGTAGCAAGAAGG + Intergenic
1108146376 13:47481595-47481617 TTGAAGATGTGTAAGCAAGAGGG + Intergenic
1108158572 13:47614294-47614316 TTGAATAGGAGTAGGGAGAGAGG + Intergenic
1108231863 13:48352891-48352913 TTGAATAGGAGTGGTGAAAAAGG + Intronic
1109146536 13:58786912-58786934 TTGAATAGGAGTAATGAGAGAGG + Intergenic
1109526524 13:63582567-63582589 TTGAATAGGAGTGGTGAAAATGG + Intergenic
1109748022 13:66652106-66652128 TTGAATAACAGTGATGAAGATGG - Intronic
1109928253 13:69176985-69177007 TTGAATAGGAGTAATGAGAGTGG - Intergenic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1110776215 13:79411188-79411210 TTGAAAAAGAGCAAAGAAGAGGG - Intergenic
1110861786 13:80352048-80352070 TTGAAAAGTAGTTATGAAGATGG - Intergenic
1111036419 13:82680431-82680453 TTGAATAGGAGTAGTGAGAATGG + Intergenic
1111848598 13:93543062-93543084 TTGAATAGGAGTGTGAGAGAGGG + Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1114474378 14:22983320-22983342 GTGAAAAGGAGTCAGGAAAATGG + Intergenic
1114958539 14:27853015-27853037 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1115212165 14:30978569-30978591 TTGAATAGGAGTGATGAAAGAGG - Intronic
1115224722 14:31090608-31090630 TGAAATAGGAGGAAGTAAGAAGG - Intronic
1115283914 14:31696472-31696494 TTGAAAAGTTCTAAGGAAGAAGG - Intronic
1115520920 14:34232111-34232133 CAGAATGGCAGTAAGGAAGAAGG + Intronic
1115569867 14:34656370-34656392 TACAATAGGAGTTAGGAGGAGGG - Intergenic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115828732 14:37310144-37310166 GTGAGTAGGACAAAGGAAGAGGG - Intronic
1115885377 14:37965939-37965961 TTGAATAGGAGTGATGAGAAAGG + Intronic
1115901851 14:38160196-38160218 TATAATAGTAGCAAGGAAGAGGG - Intergenic
1116389946 14:44380096-44380118 TTGAGAAGGAGAAAGGAAAAAGG + Intergenic
1116687854 14:48064833-48064855 ATGTATAGGAGTAATGAAAATGG - Intergenic
1117165329 14:53027370-53027392 AGGAAAAGGAGTAGGGAAGATGG - Intergenic
1117556899 14:56895308-56895330 TTGGATAGAAGTCAGGGAGACGG + Intergenic
1117635995 14:57744179-57744201 TTGAATAGGAGTGTGAGAGAGGG - Intronic
1118463625 14:66010939-66010961 TTGAATAATTGTAAGGAACATGG - Intergenic
1118656346 14:67953967-67953989 TTGAATAGAAGAAAAGAAGGTGG + Intronic
1118716948 14:68566853-68566875 TTGAAGAGTAATAAGAAAGAAGG - Intronic
1118886109 14:69867210-69867232 TTGCAGAGGAGTGAGGAAGCTGG + Intronic
1118950360 14:70431194-70431216 TTGAATAGGAGTTGTGATGAGGG + Intergenic
1119854417 14:77888610-77888632 TGTAATGGGAGTAAGGGAGATGG + Intronic
1119980069 14:79070637-79070659 TAGAATAATAGTAAGGAAAATGG - Intronic
1120249115 14:82040577-82040599 TTGCAAGGGAGTCAGGAAGAGGG + Intergenic
1120400084 14:84020060-84020082 TTGAATAGAAGTGATGAAAATGG - Intergenic
1120439777 14:84521252-84521274 CTGCACAGGAATAAGGAAGAGGG + Intergenic
1120588101 14:86341096-86341118 TTGAATAGGAGTGATGAGAAAGG - Intergenic
1202887656 14_KI270722v1_random:122840-122862 TTGAATAGGAGTGATGGAAAAGG + Intergenic
1124021040 15:25923572-25923594 TTGAATAGGAGTAGTGAAGGAGG + Intergenic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1124724304 15:32141958-32141980 TTGAATAGGAGTGGTGAAGAGGG + Intronic
1124912849 15:33939225-33939247 TTGTATAGAAGTGAAGAAGAGGG - Intronic
1126162117 15:45623041-45623063 GAGAATTGGAGTAAGAAAGAGGG + Intronic
1126502199 15:49358190-49358212 TTGAATAGGAGTGGTGAGGAGGG - Intronic
1126535586 15:49759470-49759492 TAGAAAAGGAGTAAGGATGAAGG + Intergenic
1126561767 15:50051995-50052017 TTGAATGGGAACAAGGAACAAGG + Intronic
1126568074 15:50120807-50120829 TAGAATTGGAGTAAGGAATCAGG + Intronic
1126654476 15:50961707-50961729 TTGAATAGGAGTGATGAAAGTGG - Intronic
1126867022 15:52947819-52947841 TGGAATAAGAGAAAGGAAGCGGG + Intergenic
1126905088 15:53356416-53356438 TGGGAAAGGAGTAAGAAAGAGGG - Intergenic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127697394 15:61463816-61463838 TTGGAGAGGACTAAGGGAGAAGG - Intergenic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128357479 15:66938239-66938261 TTGTGTAGGAGTGAGGAATACGG - Intergenic
1128850604 15:70951798-70951820 TTGAATAGGAGCAGTGAAAATGG + Intronic
1129149243 15:73677319-73677341 TGGAAAAGGAGTAGGGAAGTTGG + Intergenic
1130490589 15:84427491-84427513 TAGCATAGGAGTGAGGAAGCAGG - Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131558015 15:93415879-93415901 TGGAATTGGAGTGAGGAGGAAGG + Intergenic
1132254092 15:100359679-100359701 TTGAATAGAAGTGATGAAAATGG - Intergenic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1133738247 16:8631914-8631936 CTGCATAGGGGTGAGGAAGAAGG - Intronic
1133832722 16:9338996-9339018 TTGAATAACAGTAGGGAGGAAGG + Intergenic
1135046148 16:19157573-19157595 TTCCATAAGAGAAAGGAAGATGG + Intronic
1135562679 16:23488513-23488535 TTGAATCGGAGTATGGAGGGGGG - Intronic
1137662818 16:50224066-50224088 TTGAAAATGAGTAAGGAAAGGGG + Intronic
1138408897 16:56822141-56822163 GTGGCTAGGAGGAAGGAAGAAGG + Intronic
1140163736 16:72527332-72527354 TTGAATAGGAGTGGTGAGGAGGG + Intergenic
1140750638 16:78020213-78020235 TTTAAAAGGATTTAGGAAGATGG + Intergenic
1140954870 16:79853578-79853600 TTGAATAGGAGTAATGAGAGAGG + Intergenic
1142911480 17:3097300-3097322 TTGAATAGAAGTAATGAAAGTGG - Intergenic
1143240345 17:5438602-5438624 TAGAATAAGACTAAGGAAAAAGG + Intronic
1143721450 17:8813861-8813883 TTGAATAGGAGTAGTGACGGTGG - Intronic
1144427946 17:15162057-15162079 ATGACTAGGAATAAGAAAGATGG + Intergenic
1144935870 17:18898382-18898404 TGGAATATCAGCAAGGAAGAAGG - Intronic
1146559508 17:33855995-33856017 AAGAAAAGGAGCAAGGAAGAAGG + Intronic
1148153422 17:45409794-45409816 ATGAACAGGAGCAAGGAGGAGGG - Intronic
1148188522 17:45662049-45662071 TTCAAAGGGAGGAAGGAAGATGG + Intergenic
1148354227 17:46964714-46964736 TTGAAGAGGTGTGAGGAAGTAGG - Intronic
1150605103 17:66684002-66684024 AGGAATAGTTGTAAGGAAGATGG - Intronic
1150850085 17:68696058-68696080 ATGAATAGGAGTTAGGCAGGAGG - Intergenic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1152372087 17:79895000-79895022 TTGAATGGAAGGAAGAAAGAGGG - Intergenic
1153391915 18:4572020-4572042 TTGAATAGGAGTAATGAAAGTGG + Intergenic
1153498525 18:5723939-5723961 CTAAATAGGAGTAAGGAACCAGG + Intergenic
1153734942 18:8057168-8057190 TTGAATAGGAAGTAGGAAGGTGG + Intronic
1153809793 18:8741980-8742002 CTGAATAGGATCAAGGAAGCAGG - Intronic
1153894918 18:9549949-9549971 TTCCTTAAGAGTAAGGAAGAGGG + Intronic
1154481359 18:14829397-14829419 TTGAATAATAGAAAGGAAAAGGG + Intronic
1155712132 18:28895271-28895293 TTGAGTAGGAGTAGGAAAGGTGG - Intergenic
1155716844 18:28954235-28954257 TTGAATAGGAGTGGCAAAGAGGG - Intergenic
1155799176 18:30079524-30079546 TTAAATAGGAGTAGTGAAAATGG + Intergenic
1156080639 18:33330608-33330630 ATCAATAGGAGCGAGGAAGATGG + Intronic
1156520531 18:37718860-37718882 TTTATTAGGATTAAGGAATAAGG - Intergenic
1156654172 18:39263901-39263923 TTGAATAGGAGTGGAGAGGAAGG - Intergenic
1156669120 18:39446423-39446445 TTGAATAGGAGTGATGAAAGAGG - Intergenic
1156896414 18:42251739-42251761 TTGAATAGGAGCAATGAGGGAGG + Intergenic
1157019891 18:43768078-43768100 TTAAATAGGAGTAATGAGAAAGG + Intergenic
1157112616 18:44835094-44835116 TTGAAGAGTATTAAGGATGAGGG + Intronic
1157134035 18:45036705-45036727 GAGAATAGGAGGAAGGAAGGAGG + Intronic
1158747891 18:60222746-60222768 TTGAATAGGAGTAATGAAAGTGG + Intergenic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162829696 19:13276587-13276609 TTGAAGAGCAGCAAGGAAGCTGG - Intronic
1162923528 19:13918363-13918385 TGGAAGAGGATTAAGCAAGATGG + Intronic
1164209656 19:23087973-23087995 TTGAATAGGAGTGATGAAAGAGG + Intronic
1164315385 19:24082920-24082942 TTGAATAGAAGTGATGAAAATGG - Intronic
1166035498 19:40165267-40165289 TGCTATGGGAGTAAGGAAGAGGG - Intergenic
1166437704 19:42783125-42783147 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166456652 19:42946923-42946945 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166486401 19:43217417-43217439 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166493516 19:43280844-43280866 TTGAAAAGGAAAAAGGAAGCTGG + Intergenic
1167982811 19:53290030-53290052 TAGCATAGGATTAGGGAAGATGG + Exonic
1168498728 19:56875686-56875708 CTGAGTAGGAGTAAGGAGGGAGG + Intergenic
925513201 2:4650356-4650378 TTGAATAGGAAAGAGGAAGCAGG - Intergenic
925793973 2:7523096-7523118 ATGAACTGGAGAAAGGAAGACGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926986973 2:18635158-18635180 TTGAATAGGAGTGATGAGAAAGG + Intergenic
927474924 2:23405886-23405908 ATGGGTAGGTGTAAGGAAGAGGG + Intronic
928185507 2:29106692-29106714 TTGAAAAGCAGTATGGAAGCTGG - Intronic
928314988 2:30238025-30238047 TTGAATTAGGGTAAGGAAGAAGG - Intronic
928336156 2:30400228-30400250 TTGAAAAGGAGTAATGAGGTTGG - Intergenic
928534281 2:32225044-32225066 TTTCCTAGGAGTAAGGAAAAGGG - Intronic
928644144 2:33334207-33334229 TTAAAAAGGAGTAAGAAATATGG + Intronic
928654299 2:33434163-33434185 TGTAATAGCAGAAAGGAAGAAGG - Intergenic
930326107 2:49920603-49920625 TTGAAAAGCAGGAAGGAAGAGGG - Exonic
930531117 2:52589625-52589647 TTGAATAGGAGTGATGAGAAAGG + Intergenic
931134427 2:59380858-59380880 TTGAATAGGAGTGGTGAAAATGG - Intergenic
932008263 2:67949360-67949382 GTGAGTAGAAGTGAGGAAGAAGG - Intergenic
933044417 2:77517938-77517960 TTGTAATGGAGTAAAGAAGAGGG - Intronic
933305792 2:80596745-80596767 TTGAATAGGAGTGATGAGAAAGG + Intronic
933377009 2:81492436-81492458 TTTAATAGGAGTGATAAAGAGGG + Intergenic
933482281 2:82872552-82872574 TTGAATAGAAGTGATGAAAATGG + Intergenic
934331895 2:92075734-92075756 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936172431 2:110188119-110188141 TTGAATAGGAGCAATGAGGGAGG - Intronic
937318118 2:120944961-120944983 AAGAATGGAAGTAAGGAAGAGGG - Intronic
938125054 2:128665242-128665264 TCCTATAGGAGAAAGGAAGAGGG - Intergenic
938507319 2:131900091-131900113 TTGAATAGGAGTGATGGAGAGGG - Intergenic
938600605 2:132834851-132834873 TTGAATAGGAGTTATGAAAGTGG + Intronic
939241679 2:139569181-139569203 TTGAATAGGAGTGGGGAAAGTGG - Intergenic
939514942 2:143154670-143154692 TTGAAGAGGATTATGGATGAGGG + Intronic
939648034 2:144725403-144725425 TTGAATATGAGTAATAAAAATGG - Intergenic
939860280 2:147411966-147411988 TTGAATAGGAGTAATGAAAGAGG + Intergenic
940131114 2:150383333-150383355 TTGAATAGAAGTAATGAAAGTGG + Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940208536 2:151232166-151232188 TTGAATAGGAGTAGTGAAAGTGG - Intergenic
940706851 2:157116450-157116472 TTGAATAGGAGTGGTGAAAATGG - Intergenic
940708258 2:157130724-157130746 TTGAATAGGAGTGGTAAAGAGGG - Intergenic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
942422187 2:175819808-175819830 TTGAATAGGACTAAAGGTGATGG - Intergenic
942624667 2:177887112-177887134 TTGATTAGGGGTCAGGAAGCTGG + Intronic
943093477 2:183401517-183401539 TTGAATAGGAGTGATGAGAAAGG + Intergenic
943490759 2:188553218-188553240 TTGAATAGGAGTGATGAAGGTGG + Intronic
943823704 2:192361144-192361166 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
943913710 2:193601338-193601360 CTGAATATTACTAAGGAAGATGG + Intergenic
944370956 2:198983260-198983282 TTGAATAGGAGTGGTGAAGAGGG - Intergenic
944849163 2:203699994-203700016 TTGAATAGGAGTGTGAAAGAGGG - Intergenic
944996237 2:205297385-205297407 GAGAGTAGGAGTAGGGAAGAGGG + Intronic
945395564 2:209311695-209311717 ATGAATAGGAGAAGGCAAGAAGG + Intergenic
945628043 2:212236004-212236026 TTGAATAGGAGTGATGAGAAAGG + Intronic
945649832 2:212543349-212543371 GTGAGTGGGAGTAAAGAAGAAGG - Intergenic
945877681 2:215295377-215295399 TTTAAAAGGAATAAGGGAGAAGG + Intergenic
1168809930 20:698591-698613 TTGAATTCCAGTAAGGGAGAGGG + Intergenic
1169603052 20:7284132-7284154 TTGAGTAGATGTATGGAAGATGG - Intergenic
1169658574 20:7953574-7953596 TTAAATAGGAGTGGGAAAGAGGG + Intergenic
1170082843 20:12495694-12495716 TTGAATAGGAGTGTGAGAGAGGG - Intergenic
1170474385 20:16700652-16700674 TTAAATGGAAATAAGGAAGACGG - Intergenic
1171099523 20:22369786-22369808 GTGACAAGGAGCAAGGAAGATGG - Intergenic
1171239824 20:23556820-23556842 TTGAATAGGAGTGAGAGAGAGGG + Intergenic
1172857893 20:38021976-38021998 ATGAATACGAACAAGGAAGAGGG + Intronic
1173025430 20:39303313-39303335 TTTAAGAGAAGGAAGGAAGAAGG - Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1174121540 20:48269430-48269452 TTTAATGGGAGAAAGAAAGAAGG - Intergenic
1176031638 20:63015748-63015770 TTGAGCAGCAGGAAGGAAGATGG - Intergenic
1176744043 21:10635169-10635191 TTGAATAGGAGTGATGAGAAAGG - Intergenic
1176786310 21:13260236-13260258 TTGAATAGGAGTGATGGAGAGGG + Intergenic
1176799251 21:13407212-13407234 TTGAATAATAGAAAGGAAAAGGG - Intergenic
1176865727 21:14053734-14053756 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
1177111834 21:17038200-17038222 TTGAATAGGAGTGGTGAAAAAGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177480165 21:21676135-21676157 TTAATGAGGGGTAAGGAAGAGGG + Intergenic
1177984918 21:27962308-27962330 ATGAATAGGAGTGATGGAGAGGG + Intergenic
1178389086 21:32184072-32184094 TTTAACAGGAGTCAGGGAGAGGG - Intergenic
1178581432 21:33841712-33841734 ATGAATAGGATTAATGAAGCAGG - Intronic
1179037996 21:37776385-37776407 TTGAATAGGAGTGGGGAAAGAGG + Intronic
1179095580 21:38311655-38311677 CTTAATAGGAGTCAGGAAGAAGG + Intergenic
1181846498 22:25713686-25713708 TTGAATATGAGCAAAGAAAATGG - Intronic
1182417017 22:30227912-30227934 TTGAATAGGAGGCAGCAAGGAGG - Intergenic
1183875107 22:40773576-40773598 TAGAATAGGAGTACTGGAGAAGG - Intronic
1185083794 22:48724953-48724975 TAGAGTAGGAGTAAGCAAGAGGG + Intronic
950932504 3:16804587-16804609 CTGATTCAGAGTAAGGAAGAAGG + Intronic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951131766 3:19055103-19055125 CTGAATAAGAGTAAGGAATTTGG - Intergenic
951596652 3:24325964-24325986 TTAAAGAGGAGAAAGGGAGAGGG - Intronic
951960577 3:28314660-28314682 TGGAATAGGAAGAAGGAACAAGG - Intronic
952206863 3:31188970-31188992 CTGAAAAGAAGAAAGGAAGAGGG + Intergenic
952250899 3:31652781-31652803 TTGAATAGGAGTAGTGAAAATGG - Intergenic
952864324 3:37842339-37842361 TTGAATAGGAGTAGGGAGAGAGG - Intergenic
953104594 3:39864254-39864276 TTGAATAGGAGTGATGAGAAAGG - Intronic
953155624 3:40369808-40369830 TTGAATAGGATTAATGAATGTGG - Intergenic
954525388 3:51265800-51265822 TTGAATAGGAGTGTGAGAGAGGG - Intronic
954789937 3:53124644-53124666 TTTAAAAGCAGGAAGGAAGAGGG - Intronic
955827104 3:62959577-62959599 TTGAATAGAAGTAGTGAAAATGG + Intergenic
957275232 3:78082403-78082425 ATGCATAGCAGTAATGAAGACGG - Intergenic
958894037 3:99810615-99810637 TTGCCAAGGAGTAAGGGAGAGGG + Intergenic
958998640 3:100936015-100936037 TTGAATAGGAGTGGGAGAGAGGG + Intronic
959432767 3:106275330-106275352 ATGAATAGGAGAAAGAAAGGCGG - Intergenic
959820637 3:110730802-110730824 TTGAATAGAAGAAAGAAACAAGG + Intergenic
960325855 3:116295235-116295257 CTGAATAAAAGTAAGGATGAGGG + Intronic
960611721 3:119560652-119560674 TTGAATAGTTGCAAGGAATATGG + Intergenic
960637199 3:119795484-119795506 GAGAATAGGAGAAAAGAAGAGGG - Intronic
960850509 3:122047990-122048012 TTGAATAGAAGTGATGAAGTAGG + Intergenic
961015629 3:123466020-123466042 TTGAATGGGAGAAAGGGATAGGG + Intergenic
961902397 3:130225681-130225703 AGGAATAGAAGTAAGAAAGAAGG + Intergenic
962330088 3:134470895-134470917 TTGAATAAGAGCAAGGGAGAGGG + Intergenic
962451573 3:135522470-135522492 TTGAATAGGAGTGATGAGAAAGG - Intergenic
962821384 3:139050604-139050626 TTGAATAGGAGTGGTGAAAATGG + Intronic
962856349 3:139349221-139349243 TTGAAAAGGAGAAAGGAACTTGG + Intronic
962999090 3:140660047-140660069 TTGAATAGGAGTGATGAAAGTGG - Intergenic
963417493 3:145016429-145016451 TTGAATAGGAGTAATGAGAGTGG - Intergenic
963980635 3:151532777-151532799 TTGAATAGGAGTGTGAGAGAGGG - Intergenic
965698564 3:171436151-171436173 CTGTATAGGAGTGGGGAAGATGG - Intronic
965886969 3:173457911-173457933 TGTAATAGGAGTTAGGGAGATGG + Intronic
965959471 3:174411825-174411847 TTGCATAGGGGAGAGGAAGATGG - Intergenic
966512361 3:180778143-180778165 TTGAATAGGAGTAGTGAAAATGG + Intronic
967131368 3:186473661-186473683 TTGAAAACAAGTAAGGAAGCAGG + Intergenic
967246723 3:187494465-187494487 TTGAATAGAAGTAATGAAAGTGG - Intergenic
967389325 3:188940115-188940137 ATGAATAGGATTTAGGCAGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967689033 3:192452037-192452059 TTGAATAGAAGTAATGAAAATGG + Intronic
969278320 4:6152034-6152056 TTGGAAAGGAGAAAGGAAGCAGG + Intronic
969355137 4:6620710-6620732 TTGGAAAGAAGGAAGGAAGATGG + Intronic
969834437 4:9828664-9828686 ATGAAGAGGAGTAAGAAAGCAGG - Intronic
970153194 4:13112587-13112609 TTGAATAGGAGTAATGAAAGTGG - Intergenic
970795215 4:19904325-19904347 GTGAATTGGACTAGGGAAGAAGG - Intergenic
971296532 4:25398505-25398527 TTGAATGAGAGTAAGGTAGGAGG + Intronic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971833948 4:31737323-31737345 TTGAGTAGGAGTAAAGAAATAGG + Intergenic
971858115 4:32069520-32069542 TTGAATAGGAGTGATGAAAATGG + Intergenic
971953503 4:33384913-33384935 TTGAATAGGAGTGATGAAAGTGG + Intergenic
972000023 4:34019554-34019576 TTGAATAGGAGCAGTGAAAATGG + Intergenic
972115861 4:35633135-35633157 TTGAATAGGAGTAGTGAAAGAGG - Intergenic
973094739 4:46182264-46182286 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
973399345 4:49625014-49625036 TTGAATAGGAGTGAGGAGAGAGG - Intergenic
973596193 4:52492936-52492958 TTGAATAGGAGTCCTGAAAATGG - Intergenic
973685745 4:53367780-53367802 TTGTATAGGAGTCAAGAAGGAGG + Intergenic
974427196 4:61756657-61756679 TTGAATAGGAGTGGTGAAAAAGG + Intronic
974470562 4:62313349-62313371 TTGAATAGGAGTGATGAGAAAGG - Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
974787275 4:66635376-66635398 TGTAATAGGAGTCTGGAAGAGGG - Intergenic
974885723 4:67814635-67814657 TTGTTTAGGTGTAAGGAAGGGGG - Intergenic
974888978 4:67855648-67855670 TTGAATAGGAGTGATGAAAGTGG - Intronic
975308091 4:72871955-72871977 TTGAATAGGAGTGTGAGAGAGGG - Intergenic
975410884 4:74048002-74048024 TTGAAGAGGAGTAACGAAAATGG + Intergenic
975613686 4:76225425-76225447 TTGAATAGCAGTGATGAAAATGG + Intronic
975726564 4:77297514-77297536 TTGAATAGGAGTAGGGAGAGAGG + Intronic
975943145 4:79672276-79672298 TTGAATAGAAGTAGTGAAAATGG - Intergenic
976620703 4:87124294-87124316 TTTAGTGGGAGTAAGGAAAAGGG - Intronic
976676044 4:87704631-87704653 ATGAATAGGGGAAGGGAAGAGGG + Intergenic
977052777 4:92150299-92150321 TTGAATAGGAGTGATGAAAGTGG - Intergenic
977150801 4:93508979-93509001 GTGAATATGAGTAAGGCAAAAGG + Intronic
977448228 4:97159359-97159381 TTAAATGTGAGTAAGGAAAAGGG - Intergenic
977973697 4:103240119-103240141 TTGAATAGGAGTAGTGAAGGAGG + Intergenic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979283739 4:118897424-118897446 TTAAACAGGATGAAGGAAGAGGG - Intronic
979608087 4:122660333-122660355 CTGAATTGGAATAAGGAATAAGG - Intergenic
980245881 4:130242196-130242218 TAGAATAGTAGTAATGAAGGTGG + Intergenic
980490040 4:133512705-133512727 TTGAATAGGAGTAGTGAAAGGGG - Intergenic
980729540 4:136809430-136809452 TTTCATAGGAGAAAGGGAGATGG + Intergenic
980794161 4:137659332-137659354 TTGAAAAGGAATAAATAAGAAGG - Intergenic
980941041 4:139274355-139274377 TTTAATAGGGGAAAGGAGGAGGG + Intronic
981063472 4:140454144-140454166 TTGAATAGGAGTGGTGAGGATGG + Intronic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
981284091 4:142994985-142995007 TTGAATAGGAGTGAGGAGAGGGG - Intergenic
981453731 4:144929637-144929659 TTGAATAAGAGTGGTGAAGAGGG + Intergenic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982528032 4:156504372-156504394 TTGAATAGAAGTGAGGAAAGTGG - Intergenic
982762759 4:159306670-159306692 TTGAATAGGAGTGGGAAAGTGGG + Intronic
983317539 4:166151249-166151271 TTCACTAGATGTAAGGAAGAGGG + Intergenic
983373473 4:166895411-166895433 AAGAATGGGAGTAAGCAAGAAGG + Intronic
983776378 4:171612430-171612452 TTGAATAGAAGTGATGAAAATGG - Intergenic
983990559 4:174114322-174114344 TTGAGGAGTAGAAAGGAAGAGGG + Intergenic
984076019 4:175180879-175180901 TTGAATAGGAGTGATGAAGGAGG + Intergenic
984114383 4:175661495-175661517 TTGAAAAGGAGCAATGAAGAAGG + Intronic
984384170 4:179034018-179034040 TTGAATAGGAGTGGTGAAAAAGG - Intergenic
985128418 4:186718183-186718205 TTTAAGAGGAGGAGGGAAGATGG - Intronic
985263632 4:188138181-188138203 TTGACTAGGAGAAAGGAAGGTGG + Intergenic
985290822 4:188385384-188385406 TTGAATAAGAGTAGTGAAAATGG + Intergenic
985392615 4:189506055-189506077 TTGAAAAGCAGTAACGAAGTGGG - Intergenic
986487815 5:8257726-8257748 TTAAATAGAAGTAGGGAAAATGG + Intergenic
986609298 5:9550983-9551005 TGGAACTGGAGTCAGGAAGACGG - Intergenic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
987120086 5:14759324-14759346 TCAAATAGGAATAGGGAAGAAGG + Intronic
987180263 5:15360224-15360246 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
987670062 5:20995064-20995086 TTGAATAGGAGTGTGGGAGTAGG - Intergenic
987900824 5:24009494-24009516 TTGAATAGGAGTGATGTACAGGG + Intronic
987957433 5:24758827-24758849 TTGAATAAGAGTAGTGAAGGTGG + Intergenic
988118988 5:26935340-26935362 TTGAATAGGAGTGATTAAGAGGG - Intronic
988319696 5:29678023-29678045 TTGAATAGAAGTAATGAGAAAGG + Intergenic
989148843 5:38277514-38277536 TTTAATAAGAGTAGGGAAAATGG - Intronic
989288220 5:39729267-39729289 TTGAATAGGGGTAATGAGAATGG + Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
990005753 5:50942398-50942420 TTGAATAGAAGTGAGGAAAGTGG - Intergenic
990230549 5:53708692-53708714 TTGAATAGGAGTGGGGAGAAAGG + Intergenic
990425871 5:55688295-55688317 TTGAATAGGAGTAGTGAGGGAGG + Intronic
991150780 5:63366229-63366251 TTGAATCAGAGAAAGCAAGATGG - Intergenic
991292680 5:65047934-65047956 TAAACTGGGAGTAAGGAAGAGGG - Intergenic
991782121 5:70148694-70148716 TTGAATAGGAGTCATGAGGGAGG - Intergenic
991844436 5:70844530-70844552 TTGAATAGGAGTCATGAGGGAGG + Intergenic
991874564 5:71149009-71149031 TTGAATAGGAGTCATGAGGGAGG - Intergenic
991910453 5:71555207-71555229 TTGATTTGGTGTAAGGAATAGGG + Intronic
991948061 5:71920093-71920115 TTGAATAGGAGTAGTGAAAGCGG - Intergenic
992887931 5:81177363-81177385 TCGAAGAGGAGTAAGGAGAAGGG + Intronic
993146634 5:84102270-84102292 TTGAATAGGAGTGATGAGAAAGG - Intronic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
994294044 5:98067649-98067671 TTTAATAGCAGTAAGTAAGGGGG + Intergenic
994423004 5:99545781-99545803 TTGAATAGGAGTAGTGAGAAAGG + Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
994725741 5:103433423-103433445 GAGAATAGGAGTGAGCAAGAGGG - Intergenic
994944564 5:106369413-106369435 TTGAATAGCAGTGATGAACATGG - Intergenic
994993821 5:107033953-107033975 ATGAATAGGAATTAGCAAGAGGG + Intergenic
995253928 5:110024099-110024121 TTGAATAGGAGTAGTGAGAATGG - Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995431213 5:112079949-112079971 TTGAATAGGAGTGATGAAAGAGG + Intergenic
995811325 5:116109908-116109930 TTAAATAGGAGTAGTGAAAATGG + Intronic
996046340 5:118877641-118877663 TTGAATAGGAGTAGTGAAAGAGG - Intronic
996662450 5:126020469-126020491 TGGAACAGGAGGAAGGAAGCAGG - Intergenic
996757605 5:126951012-126951034 TGGAATGGGAGTAAGAAAGAAGG - Intronic
996784192 5:127220655-127220677 TTGAATAGGAGTAGGGAGAGAGG - Intergenic
996914380 5:128694699-128694721 TTAAATAGGATTAAGGAGGTTGG - Intronic
997019797 5:129986063-129986085 TTGAATAGGAGTCATGAGAATGG + Intronic
997661559 5:135593062-135593084 TTAAACAGGAGTCAGGAAGCCGG - Intergenic
997782100 5:136669340-136669362 TTGAATAGGAGTGGTGAAAATGG - Intergenic
997785353 5:136706255-136706277 TTGAATAGGAGTGATGAAAGTGG - Intergenic
998616526 5:143746524-143746546 TTGAATAAGAGAAAGGAATAGGG - Intergenic
998894507 5:146785195-146785217 TAGAAAAGGAGGAAGGAAGTGGG + Intronic
999519747 5:152339025-152339047 ATGAATAGGAGTAAGGGTGATGG - Intergenic
1000403823 5:160864527-160864549 TCGAATAGAAGTAATGAAAATGG - Intergenic
1000548440 5:162629883-162629905 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1000954493 5:167526704-167526726 TTGAATAGGAATTAGAAAGAAGG - Intronic
1001109263 5:168882263-168882285 TTGGAGAGGGGTAGGGAAGAAGG - Intronic
1001713793 5:173798375-173798397 TTGTACTGGAGGAAGGAAGAGGG + Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1001814414 5:174656092-174656114 TTGATAAGGACTAAGGGAGAAGG + Intergenic
1002995550 6:2280343-2280365 TTGAATAGAAGTAGTGATGATGG + Intergenic
1004092943 6:12523887-12523909 TTGAATAGGAGTGATGAAAGAGG + Intergenic
1004176895 6:13347926-13347948 GTGAAGAGGAGTCAGGAGGAAGG + Intergenic
1004293956 6:14393423-14393445 TTAAAAAGGAGGAAGGAAGGAGG + Intergenic
1004439539 6:15635859-15635881 TTAAACGTGAGTAAGGAAGAAGG - Intronic
1004644514 6:17546784-17546806 TTGAATAGGAGTAGTGAGAAAGG - Intronic
1006252785 6:32803689-32803711 TTGAATAGGAGTAATGAGAGGGG + Intergenic
1006514020 6:34536126-34536148 TTCAGGAGGAGTAAGGAAGATGG - Intergenic
1006712560 6:36087239-36087261 TTGAATAGGAGTAGGGAAAGAGG - Intronic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007314492 6:40975294-40975316 TTGAATAGGAGTAGTGAAAGAGG + Intergenic
1007352477 6:41283956-41283978 GTGAGTGGGAGGAAGGAAGAGGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1007561318 6:42810942-42810964 GAGAATAGGAGAAAGGGAGAAGG - Intronic
1008127360 6:47684065-47684087 TTGAATCCCAGTAAGGAACAGGG + Intronic
1008312886 6:49999104-49999126 TTGAATAGGAGTGATGAAAGTGG - Intergenic
1008911572 6:56739528-56739550 TTGAATAGGAGCTAGGTAAAAGG + Intronic
1009505435 6:64471197-64471219 TTAAATAAGAGTAAGGAACGTGG - Intronic
1009624514 6:66122480-66122502 TTGAATAGAAGTGGTGAAGATGG + Intergenic
1009876696 6:69514893-69514915 TTGAACAGGAGTAATGAGAATGG - Intergenic
1009921254 6:70064564-70064586 TTGAATAGGAGTGGTGAAGGAGG - Intronic
1010670459 6:78680404-78680426 TTGAATAGGAGTGATGAGGGAGG - Intergenic
1010729734 6:79378177-79378199 TTGACTAGAAGTCAGGAAGTAGG - Intergenic
1011159853 6:84376964-84376986 TTGAATAGGAGTAGTGAAAGTGG + Intergenic
1011366619 6:86589121-86589143 TGATATTGGAGTAAGGAAGAGGG + Intergenic
1012192057 6:96292053-96292075 TTGAATAGAAGTCATGAAGGTGG - Intergenic
1012410543 6:98951251-98951273 TTGAATAGAAGTGAGAAAGCGGG + Intergenic
1012556915 6:100524791-100524813 TTGAAGAGGAGGAAGGATAAAGG - Intronic
1012714055 6:102646829-102646851 TTGAATAGGAGTGATAAAAATGG - Intergenic
1012818322 6:104053267-104053289 TTTAATATGAGGGAGGAAGAGGG + Intergenic
1013875402 6:114820463-114820485 TTGAATAGTAACAATGAAGATGG + Intergenic
1014059719 6:117057354-117057376 TTGAATAGGAGTGATGAAAATGG + Intergenic
1014166775 6:118233788-118233810 ATGAATAGGAGTTTGCAAGATGG + Intronic
1014375501 6:120667322-120667344 TTGAATAGGAGTGTGAGAGAGGG + Intergenic
1014884060 6:126757883-126757905 GTGACTAGGAGAAAGGAGGAGGG - Intergenic
1014886296 6:126785407-126785429 ATGAAGAGTAGGAAGGAAGAAGG - Intergenic
1015232104 6:130926931-130926953 TTGAGTAGCAGTAAAGCAGACGG - Intronic
1015987403 6:138898201-138898223 ATGAATAGAACTAAGGATGAGGG - Intronic
1016382364 6:143498127-143498149 ATGAATGGGAGCAAAGAAGAAGG + Intronic
1016390199 6:143566680-143566702 TTGACTATGAGTTAGTAAGAGGG - Intronic
1016606915 6:145940098-145940120 TTGAATAAGATTAAGGTAGAAGG + Intronic
1019156576 6:170043163-170043185 CTGAAAAGGAGTTTGGAAGAAGG - Intergenic
1021306274 7:19036270-19036292 TTGAATAGGAGTGATGAGAAAGG + Intronic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1022227968 7:28382945-28382967 TTGAGTAGGAATAGGGAACAAGG + Intronic
1022512117 7:30944184-30944206 TTGAATAGGAGTAGTGAAAGAGG + Intronic
1023185087 7:37524646-37524668 TTAAATAGGAGGAAGGAAAATGG - Intergenic
1024165786 7:46728649-46728671 TTGAATAGGAGTGATGAAAGAGG - Intronic
1024872333 7:53979941-53979963 TTTATTTGCAGTAAGGAAGAAGG - Intergenic
1025275532 7:57579005-57579027 GTGACAAGGAGGAAGGAAGAGGG - Intergenic
1025600822 7:62995243-62995265 TGGAATAGGAGTGGTGAAGAGGG + Intergenic
1026615577 7:71900267-71900289 TTGAATAGGAGTGGTGAAAATGG - Intronic
1027519348 7:79184616-79184638 TTGCATAGGAGAAAAGCAGAAGG + Intronic
1028520469 7:91724625-91724647 TTGAGTAGGAGTGATGAAAATGG - Intronic
1028787358 7:94810749-94810771 TTGAATAGGAGTGGGGAAAGTGG - Intergenic
1028814856 7:95132222-95132244 TTGAATAGGAGTAATGAGAGTGG + Intronic
1030095042 7:105891251-105891273 CTGAATAGGAGGATGGGAGAGGG - Intronic
1030910013 7:115235734-115235756 TTGAATAGGACTAATGAGCAAGG + Intergenic
1031136138 7:117886238-117886260 TTGGATTGGAGTAAGGGAGAAGG + Intergenic
1031469710 7:122154483-122154505 TTAAGTAGAAGCAAGGAAGAAGG + Intergenic
1031944125 7:127820717-127820739 TTGAGGAGGAGGAAGGAAAATGG - Intronic
1032300336 7:130680602-130680624 CTCAATAGGAGAAAGGCAGAGGG + Intronic
1032622631 7:133552630-133552652 TAGAATGGGAGTAATGAGGAGGG + Intronic
1033449351 7:141448927-141448949 GTGAACAGGAGGAGGGAAGAGGG + Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1034318006 7:150152177-150152199 TTGAATAGGAGTGGTGAAGAAGG + Intergenic
1034354262 7:150439368-150439390 TTGCAGAGCAGTAAGGAAAATGG + Intergenic
1035382880 7:158451074-158451096 TTAAATTGGAGTGATGAAGACGG - Intronic
1036633911 8:10534669-10534691 TTGAATAGGAGTGATGAAAGAGG - Intronic
1037030491 8:14098515-14098537 CTGAAAAGGTGTAAGGAAAAGGG - Intronic
1037440877 8:18914406-18914428 TTGAAAAGGAATAAGTAAAATGG + Intronic
1037699303 8:21259439-21259461 TTGAATAGGAGTAATGAGATGGG - Intergenic
1038663418 8:29516846-29516868 ATGGATAGGAGGAAGGAAGGAGG + Intergenic
1039642953 8:39243733-39243755 TTGAATAGAAGTGATGAAAATGG - Intronic
1040599203 8:48868091-48868113 TTGAACAGAACTGAGGAAGATGG - Intergenic
1040808179 8:51418966-51418988 TTGAGTTGGAGTAAGGGAGCTGG + Intronic
1041898210 8:62951114-62951136 TTGGATAGGAGTAGTGGAGATGG + Intronic
1042079999 8:65041103-65041125 TAAAATAGGAGTAAGGAAAAAGG + Intergenic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042410852 8:68463895-68463917 TTGAATAGGAGTAGTGAAAGAGG - Intronic
1042725584 8:71872088-71872110 TTGAATAGGAGTGATGAAATTGG + Intronic
1043093197 8:75930267-75930289 TTGAATAGGAGTAGTGAGAAAGG - Intergenic
1043129062 8:76438457-76438479 TTGAATAGGAGTAGTGAGAAAGG + Intergenic
1043738820 8:83781085-83781107 TTGAATAGGAGTGGTGAAAATGG + Intergenic
1044299366 8:90565834-90565856 ATGACTAGGAGGAAGGAAAATGG - Intergenic
1045676221 8:104610735-104610757 TTGAATAGGAGTAGTGAGAAAGG + Intronic
1046106839 8:109676240-109676262 TTGAATAGGAGTGATGACGGAGG - Intronic
1046217532 8:111168720-111168742 TTTAATATCAGTAAGAAAGATGG + Intergenic
1046233572 8:111391264-111391286 TTGAATAGGAGTGATGAAAGAGG - Intergenic
1046961545 8:120118376-120118398 TAGAAGAGGAGAAAGGGAGATGG + Intronic
1047021502 8:120779617-120779639 CTGACTAGGACAAAGGAAGAGGG + Intronic
1047176345 8:122544454-122544476 TGGCTTAGGAGTAAGGAAAAAGG + Intergenic
1048913679 8:139161499-139161521 TTGAATAGGAGTAGTGAAAGAGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1050254261 9:3777695-3777717 TTGAAAAGTAGTATGGGAGAAGG + Intergenic
1050423786 9:5493531-5493553 TTGAAGGGAAGTAAGCAAGAGGG - Intergenic
1050501704 9:6304976-6304998 TTGAGTAGGAGGAGGGAAAAAGG + Intergenic
1052106448 9:24523100-24523122 TTGAATAGGAGTAGGGAGAGAGG + Intergenic
1052122606 9:24737477-24737499 TTGAATGAGAGTTAGGATGAAGG - Intergenic
1052168242 9:25359830-25359852 TTGAATAGGAGTAGAGAGCAGGG + Intergenic
1052233103 9:26178541-26178563 TTGTATTGGATTAAGTAAGAAGG + Intergenic
1052596764 9:30571410-30571432 TTGAATAGGAGTGATGAAAGAGG - Intergenic
1053946410 9:43313160-43313182 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055043599 9:71901706-71901728 TTGAATGAGAGGAATGAAGAGGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055569188 9:77599360-77599382 TTGAATAGGGGGAAGGAGAATGG + Intronic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056231061 9:84544939-84544961 TGGCAAAGGAGTAAGCAAGAAGG - Intergenic
1056241459 9:84651703-84651725 TTGAATGGGAGACAGGAAGATGG + Intergenic
1058104299 9:100952921-100952943 TTGAATAGGAGCAGTGAAAATGG + Intergenic
1058522429 9:105824342-105824364 TTGAATAGCAGTGATGAAAATGG + Intergenic
1059945394 9:119404132-119404154 GTGAATAGGAGCAGGGAAGGGGG + Intergenic
1060046170 9:120342886-120342908 TAGAAAAGTAGTAAGAAAGAAGG + Intergenic
1060320086 9:122550853-122550875 TTGAATAGGAGTGATGAAAGTGG - Intergenic
1060461331 9:123857474-123857496 TTAAAAAGGAGTAAGTAAGGAGG + Intronic
1203589540 Un_KI270747v1:41718-41740 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1185809992 X:3099016-3099038 ATGATCAGGAGAAAGGAAGAGGG - Intronic
1188729436 X:33629414-33629436 AGGATTTGGAGTAAGGAAGAGGG - Intergenic
1188929260 X:36086357-36086379 TTGTATAGGAGCATGGAAGAGGG - Intronic
1189551872 X:42101851-42101873 TTGATGTGGAGGAAGGAAGAGGG + Intergenic
1189679041 X:43495268-43495290 TCGAATAGAAGTAAGGAAAGTGG - Intergenic
1189863719 X:45300924-45300946 TTGAAAAGGAAAAGGGAAGATGG + Intergenic
1189924580 X:45939131-45939153 TTTGATGGGAGGAAGGAAGAAGG - Intergenic
1189997090 X:46649461-46649483 TGGAAAAGGAGTATGGAAAAAGG + Intronic
1190027240 X:46935769-46935791 TTGAATAGGAGTCATGAGAAAGG + Intronic
1191020570 X:55855920-55855942 TTGAATAGGAGTGATGAGGGAGG + Intergenic
1191163638 X:57363602-57363624 TTGAATAGGAGTGATGAGGGTGG + Intronic
1191616491 X:63175573-63175595 TTGAATAGGAGTAGTGAAAGTGG - Intergenic
1191619806 X:63203350-63203372 TTGAATAGGAGTAGTGAAAGTGG + Intergenic
1191775864 X:64812467-64812489 TTGAATAGGAGTAGTGAGGGAGG - Intergenic
1192451305 X:71246739-71246761 TGGAACAGGGGTAAGGAAAATGG - Intronic
1192689526 X:73347873-73347895 TTGAATAGGAGTGGTGAAGGTGG + Intergenic
1192863405 X:75104005-75104027 TTGAATACGAGTAGTGAAAATGG + Intronic
1193068948 X:77286936-77286958 TTGAATAGGAGTGGTGAAGGAGG - Intergenic
1193612305 X:83647434-83647456 TTGAATAGGAGTGATGAAAGTGG + Intergenic
1193623542 X:83788170-83788192 TTTAATAGGAGTAGTGAAGGAGG - Intergenic
1193890201 X:87034643-87034665 TTGAATAGGAGTGATGAAAGTGG + Intergenic
1194333205 X:92611619-92611641 TTGAATAGGAGTACTGAAGATGG + Intronic
1194557218 X:95375028-95375050 TTAAATAGGAGTAATGAAAGTGG - Intergenic
1194797669 X:98232666-98232688 TTGAATAGGAGTAGTGAGAATGG - Intergenic
1195142333 X:101974601-101974623 TTGAATAGGAGTACTGAGGGTGG + Intergenic
1195169738 X:102254937-102254959 TTGAATAGGTGTGAGGTAGTAGG + Intergenic
1195189119 X:102432163-102432185 TTGAATAGGTGTGAGGTAGTAGG - Intronic
1195710783 X:107772333-107772355 TTGAATAGAAGTAAAAACGATGG + Intronic
1195843121 X:109196092-109196114 TTGAATAGGAGTGTGAGAGAGGG - Intergenic
1196680314 X:118463485-118463507 TTGAAGAGAAGAAAAGAAGAGGG - Intergenic
1196937347 X:120742967-120742989 TTCAATAGGAGAAAGCAAAAAGG + Intergenic
1197224328 X:123941429-123941451 TTGATTTGGAGTAAGGGGGAAGG - Intergenic
1197327758 X:125115342-125115364 TTGAATAGGAGTGAGGAGAGAGG - Intergenic
1197368360 X:125595325-125595347 TTGAATAAGAGTGATGAAGGTGG - Intergenic
1197680610 X:129380328-129380350 TTGAATAGGAGTGATGAGAAAGG - Intergenic
1198224966 X:134636712-134636734 TTTAATTAGAGTAAGGATGAAGG - Intronic
1198298845 X:135314027-135314049 TTGAATACGAGTCATGAAAATGG + Intronic
1198666510 X:139029949-139029971 TTGAATAGTTGTGAGAAAGATGG - Intronic
1198979998 X:142384445-142384467 TTGAACAGGAATTTGGAAGAAGG + Intergenic
1199077604 X:143542316-143542338 TTGAATAGGAGTAGGAAAATGGG - Intergenic
1199354324 X:146843392-146843414 TTGAATAGGAGTAATGAGAGTGG + Intergenic
1199415587 X:147578981-147579003 TTGAATAGGAGTGTTGAAAATGG - Intergenic
1199436979 X:147823502-147823524 TTGAATAGGAGTAATGAGAGAGG - Intergenic
1200387881 X:155911995-155912017 TTGAATAGGAGTAGTGAAACTGG + Intronic
1200641890 Y:5730641-5730663 TTGAATAGGAGTACTGAAGATGG + Intronic
1201691123 Y:16766168-16766190 TTGAATAGGAGTGATGAAACAGG - Intergenic
1201984080 Y:19943989-19944011 GTGAATAGGAGTGATGAACATGG + Intergenic
1202367645 Y:24178063-24178085 TAGCATAGGAGCAAGGAAGGAGG + Intergenic
1202503138 Y:25492060-25492082 TAGCATAGGAGCAAGGAAGGAGG - Intergenic