ID: 1099745033

View in Genome Browser
Species Human (GRCh38)
Location 12:86690509-86690531
Sequence CCTTGAAGGACGTTGCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099745033_1099745038 2 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745038 12:86690534-86690556 CAGTCCCTCAAGGGTTCCCTTGG 0: 1
1: 31
2: 440
3: 747
4: 952
1099745033_1099745036 -8 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745036 12:86690524-86690546 CTTCAAGGCACAGTCCCTCAAGG 0: 4
1: 38
2: 235
3: 310
4: 473
1099745033_1099745044 12 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745044 12:86690544-86690566 AGGGTTCCCTTGGCTAGGGGAGG 0: 2
1: 20
2: 380
3: 568
4: 1341
1099745033_1099745041 7 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745041 12:86690539-86690561 CCTCAAGGGTTCCCTTGGCTAGG 0: 1
1: 32
2: 436
3: 726
4: 1431
1099745033_1099745037 -7 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745037 12:86690525-86690547 TTCAAGGCACAGTCCCTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1099745033_1099745043 9 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745043 12:86690541-86690563 TCAAGGGTTCCCTTGGCTAGGGG 0: 1
1: 29
2: 398
3: 575
4: 542
1099745033_1099745042 8 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745042 12:86690540-86690562 CTCAAGGGTTCCCTTGGCTAGGG 0: 1
1: 32
2: 408
3: 585
4: 568
1099745033_1099745045 13 Left 1099745033 12:86690509-86690531 CCAGATAGCAACGTCCTTCAAGG 0: 1
1: 1
2: 3
3: 28
4: 136
Right 1099745045 12:86690545-86690567 GGGTTCCCTTGGCTAGGGGAGGG 0: 2
1: 356
2: 554
3: 1111
4: 1473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099745033 Original CRISPR CCTTGAAGGACGTTGCTATC TGG (reversed) Intronic
906942469 1:50267529-50267551 CCTTGAAATACTTTGCTATGGGG - Intergenic
908598340 1:65711741-65711763 CCCTGAGGGACTGTGCTATCTGG - Intergenic
912235278 1:107844263-107844285 CCACGAGGGACGGTGCTATCCGG + Intronic
912271095 1:108209638-108209660 CCCTGAGGGACGGTGCTGTCTGG - Intergenic
913021510 1:114792540-114792562 CCGTGAGGGACTGTGCTATCTGG - Intergenic
913428430 1:118761133-118761155 CCCTGAGGGACGATGCTATCTGG + Intergenic
913430162 1:118781477-118781499 CCGTGAAGGATGGTGCTATCTGG - Intergenic
915649023 1:157294176-157294198 CCATGAAGGACTGTGCTATCTGG + Intergenic
915876467 1:159616318-159616340 CCGTGAGGGACAGTGCTATCTGG + Intergenic
916625659 1:166552615-166552637 CCATGAGGGACAGTGCTATCTGG - Intergenic
921484921 1:215704011-215704033 CCATGAACGACTGTGCTATCTGG - Intronic
922406275 1:225316548-225316570 CCATGAAGGACGGTGCATTCTGG - Intronic
1063391748 10:5654106-5654128 CCTTTAAGGACGATGTTAACTGG + Intronic
1065198862 10:23294560-23294582 CCTTGAATGAAGTTGCTCTTGGG + Intronic
1068111316 10:52684042-52684064 CCTTCAAGCAAGATGCTATCTGG - Intergenic
1070213111 10:74347362-74347384 CCATGAGGGACTGTGCTATCTGG + Intronic
1077715049 11:4572281-4572303 CCTTCAAAGACCTTGCTATCTGG - Exonic
1078686251 11:13534867-13534889 CCATGAGGGACAGTGCTATCTGG - Intergenic
1080033672 11:27688605-27688627 CCATGAGGGACAGTGCTATCTGG - Intronic
1080070603 11:28080664-28080686 CCTTGAAACACGTTGAAATCGGG + Intronic
1080275339 11:30497424-30497446 CCTTGGAAGACATTGCTGTCTGG - Intronic
1081317784 11:41651281-41651303 TCATGAGGGACGATGCTATCTGG - Intergenic
1087427721 11:98012327-98012349 CCCTGAGGGACGGTGCTATCTGG + Intergenic
1090312634 11:125755858-125755880 TCTTGAGGGACTGTGCTATCTGG + Intergenic
1090720348 11:129466992-129467014 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1090725151 11:129518311-129518333 CCATGAGGGACTGTGCTATCTGG - Intergenic
1091142242 11:133245105-133245127 ACTTCAAGGAAGTTGCAATCAGG + Intronic
1091392729 12:135707-135729 CCTTGAAGGACCAAGCTATCAGG + Intronic
1092398852 12:8154110-8154132 CCATGAAGAACAGTGCTATCAGG - Intronic
1092637458 12:10467109-10467131 CCATGAGGGACTGTGCTATCTGG - Intergenic
1093835667 12:23825285-23825307 CCGTGAGGGACAGTGCTATCCGG - Intronic
1094666138 12:32523001-32523023 CAGTGAAGGAGGTAGCTATCTGG + Intronic
1094782118 12:33803025-33803047 CCATGAGGGACGATGCTATCTGG - Intergenic
1095547425 12:43388223-43388245 CCTTGAGGGACGGTCCTATCTGG - Intronic
1095917766 12:47497513-47497535 CCATGAGGGATGGTGCTATCTGG + Intergenic
1097488375 12:60234616-60234638 CCGTGAGGGACGGTGCTATCTGG + Intergenic
1097619450 12:61922543-61922565 CTGTGAGGGACGGTGCTATCCGG + Intronic
1099238990 12:80116246-80116268 CCATGAGGGATGGTGCTATCCGG - Intergenic
1099496868 12:83359134-83359156 ACTTGAAGGAGGTGGCTATTTGG + Intergenic
1099745033 12:86690509-86690531 CCTTGAAGGACGTTGCTATCTGG - Intronic
1100739986 12:97581334-97581356 CCATGAGGGACAGTGCTATCTGG + Intergenic
1101419542 12:104538640-104538662 CCATGAAGGAGGTTACAATCTGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1103169216 12:118799363-118799385 CCGTGAGGGACTGTGCTATCCGG - Intergenic
1109762068 13:66843749-66843771 CTTTGAAAGACTTTGCTATGGGG - Intronic
1111017617 13:82402240-82402262 CCATGAGGGACTGTGCTATCCGG + Intergenic
1116758569 14:48980948-48980970 CCCTTAAGGACTTTGGTATCAGG - Intergenic
1117599937 14:57364851-57364873 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1120900971 14:89575260-89575282 CCTTGAAGGACCTTGCTATCTGG + Intronic
1123981320 15:25607224-25607246 CTTTCAAGGAGCTTGCTATCTGG + Intergenic
1140049476 16:71467634-71467656 ACTTGAAGGACGTTGGCCTCTGG + Intronic
1148403308 17:47386829-47386851 CCTTGAGAGACTGTGCTATCTGG - Intronic
1148843789 17:50516629-50516651 CCTTGTAGGACATTGCTAACAGG - Exonic
1148980980 17:51574650-51574672 CCATGAAGGACGGTGCTATCTGG + Intergenic
1149168261 17:53779923-53779945 CCATGAAGGACTGTGCTACCCGG + Intergenic
1149365397 17:55938921-55938943 CCGTGAGGGACTGTGCTATCTGG + Intergenic
1156626922 18:38920449-38920471 CCATGAGGGAAGGTGCTATCCGG - Intergenic
1158716187 18:59881765-59881787 CCCTGAGGGATGTTGCTGTCTGG - Intergenic
1159254656 18:65930812-65930834 CCATGAAGGACAGTGCTATCTGG + Intergenic
1160657329 19:280286-280308 CCTTGCAGGATGTTCCTATCAGG - Intergenic
1166884495 19:45951977-45951999 CCTTGAGGGTTGTTGCTCTCTGG - Intronic
927411093 2:22827198-22827220 CCTTCAAGGAGTTTCCTATCTGG - Intergenic
928098693 2:28422287-28422309 CCCTCAAGGAGGTTGCAATCTGG + Intergenic
928422736 2:31151695-31151717 GCTTCAAGGACATTGCCATCAGG + Intronic
940054596 2:149500408-149500430 CCGTGAGGGATGGTGCTATCTGG - Intergenic
943147751 2:184066353-184066375 CCGTGAGGGACTGTGCTATCTGG - Intergenic
944291980 2:198018175-198018197 CCATGAGGGACAGTGCTATCAGG + Intronic
945482264 2:210357902-210357924 CCATGAGGGACTGTGCTATCTGG - Intergenic
946912927 2:224485062-224485084 CCCTGAGGGACTGTGCTATCTGG + Intronic
947085986 2:226453870-226453892 CCATGAGGGACAGTGCTATCCGG + Intergenic
1169984162 20:11423319-11423341 CCTGGAGGGATGGTGCTATCTGG - Intergenic
1170448452 20:16455929-16455951 CCGTGAAGGACGGTCCTCTCAGG - Intronic
1170702743 20:18718326-18718348 CCTTGAAGGTCGCTGCCACCTGG - Intronic
1172421673 20:34824253-34824275 CCTTAAAGGAATTTGCTAGCTGG - Intronic
1172526671 20:35603967-35603989 CCTTGAGGGTCTTTCCTATCAGG - Intergenic
1173917044 20:46715430-46715452 CCTGGAAGGACCTTGCTTTCTGG + Intronic
1176986170 21:15439632-15439654 CCTTCAAGGAAGATGCAATCTGG - Intergenic
1177313179 21:19424098-19424120 CCATGAGGGATGATGCTATCTGG + Intergenic
1177694519 21:24554834-24554856 CCTTGAGAGACAGTGCTATCCGG + Intergenic
1184873804 22:47259655-47259677 CCTTGAAGGCTTTTACTATCTGG - Intergenic
951415188 3:22414751-22414773 CCGTGAGGGACTGTGCTATCTGG - Intergenic
951629173 3:24699665-24699687 CCAGGATGGACGGTGCTATCCGG - Intergenic
955350858 3:58191990-58192012 CCATGAAGGTCTCTGCTATCTGG - Intergenic
956220026 3:66892971-66892993 CTGTGAGGGACGGTGCTATCCGG + Intergenic
959605882 3:108241683-108241705 CCTTAAAGGACTTTGGGATCAGG - Intergenic
959978001 3:112483537-112483559 CCTTGAGGGACGTTGCATGCTGG + Intronic
960507083 3:118506855-118506877 CCTTGGATGATGTTGATATCAGG - Intergenic
963629354 3:147713358-147713380 CCTTGAGGGATGGTGCTATCCGG - Intergenic
964010310 3:151885086-151885108 CCATGAGGGACGGTGCTATCTGG + Intergenic
964637065 3:158869654-158869676 CTTTGTAGGACGTTCCTATCAGG - Intergenic
965618784 3:170621852-170621874 CCATGAGGGATGGTGCTATCTGG - Intronic
970304663 4:14718884-14718906 CTATGAAGGATGGTGCTATCTGG + Intergenic
970679314 4:18489108-18489130 CCATGAGGGACTGTGCTATCTGG + Intergenic
971697829 4:29929560-29929582 CCATGAGGGACAGTGCTATCCGG + Intergenic
972283798 4:37629275-37629297 CAGTGAAGGACTTGGCTATCTGG - Intronic
974813900 4:66981688-66981710 CCTTGAGAGACAGTGCTATCTGG + Intergenic
975177846 4:71308653-71308675 CCGTGAGGGACTGTGCTATCTGG + Intronic
975620385 4:76290816-76290838 CCATGAGGGACTGTGCTATCTGG - Intronic
979023068 4:115527059-115527081 CCATGAGGGACTGTGCTATCTGG + Intergenic
979043617 4:115834187-115834209 CCTTGAGGGACCTTGCTGTGAGG + Intergenic
979668337 4:123336891-123336913 CTTTGAGGGACGCTGCTATCTGG - Intergenic
981134032 4:141190024-141190046 CCATGAGGGACTGTGCTATCTGG - Intronic
983179391 4:164630380-164630402 CCATGACGGACAGTGCTATCTGG + Intergenic
984386942 4:179072775-179072797 TCTTGAAGGATGTTTCTATATGG + Intergenic
985778849 5:1859155-1859177 GCTGGAAAGACGTTGCTAACAGG - Intergenic
987924136 5:24318166-24318188 CCATGAGGGACAGTGCTATCTGG - Intergenic
988021399 5:25626888-25626910 CCTTGAGGGACTGTGCTACCCGG + Intergenic
988774923 5:34469033-34469055 CCATGAGGGACTGTGCTATCTGG + Intergenic
990098798 5:52156570-52156592 CCTTGAAGGACTGTGCTGTGAGG + Intergenic
990953514 5:61321310-61321332 CCTTGAAGGATGGTGCTAGGAGG - Intergenic
991110799 5:62897043-62897065 CCGTGAGGGACTGTGCTATCTGG - Intergenic
991934702 5:71790043-71790065 CCTTGAGAGACAGTGCTATCTGG + Intergenic
992364655 5:76079396-76079418 TCTTAAAGGAGGCTGCTATCAGG + Intergenic
993402627 5:87472558-87472580 CCATGACGGACTGTGCTATCTGG + Intergenic
994641899 5:102421062-102421084 CCATGAGGGACGGTGCTATCCGG + Intronic
994918093 5:106005112-106005134 CCATGAGGGACGGTGCTATCTGG - Intergenic
995263835 5:110136147-110136169 CCATGAGGGACCATGCTATCTGG - Intergenic
995808497 5:116080130-116080152 CCTTGAGGGAAGGTGCCATCCGG + Intergenic
996280796 5:121726924-121726946 CCGGGAAGGACTGTGCTATCGGG - Intergenic
998752141 5:145333991-145334013 CCATGAAGGACTGTGCTATGTGG - Intergenic
999602533 5:153282798-153282820 CCATGAAGGACAGTGCTATTGGG + Intergenic
1000456804 5:161459630-161459652 CCATAAAGGACGGTGCCATCAGG + Exonic
1006199896 6:32279140-32279162 CCATGAGGGACTGTGCTATCCGG + Intergenic
1011831293 6:91374888-91374910 CCATGAGGGACAGTGCTATCTGG - Intergenic
1012083135 6:94785636-94785658 CCGTGAGGGACAGTGCTATCTGG - Intergenic
1012674707 6:102100698-102100720 CCATGAGGGACGGTGCTATCTGG + Intergenic
1013920211 6:115394793-115394815 CCATGAGGGATGGTGCTATCCGG - Intergenic
1013956850 6:115852230-115852252 CCTTGAAGGACCTTGCCATGAGG + Intergenic
1014387127 6:120816403-120816425 CCTTGAGGGACCGTGCTATGAGG - Intergenic
1015433280 6:133155290-133155312 CCCTGAGGGACAATGCTATCTGG - Intergenic
1018507884 6:164491154-164491176 CCATGAGGGACTGTGCTATCTGG - Intergenic
1020487729 7:8739343-8739365 CCTTGAAGGACGGTGCATTCTGG - Intronic
1020629694 7:10625313-10625335 CCTTGAGGGACGGTGCTATCTGG + Intergenic
1021995914 7:26178363-26178385 CCTTCCAGGACCTTGCTAGCAGG + Intronic
1023697829 7:42865626-42865648 CCATGAGGGACAGTGCTATCTGG - Intergenic
1024664968 7:51536960-51536982 CCATGAGGGATGGTGCTATCTGG - Intergenic
1028991195 7:97050854-97050876 CCATGAAGGACGGTGCTATCCGG + Intergenic
1028998422 7:97127001-97127023 CCATGAGGGACTGTGCTATCCGG - Intronic
1030500874 7:110356979-110357001 CCATGAAGGATGGTGCTATCAGG - Intergenic
1037601851 8:20403363-20403385 CCTTCATGGAGTTTGCTATCAGG - Intergenic
1038843909 8:31211373-31211395 GATTGAAGGACGTTGGTATGGGG - Intergenic
1041419138 8:57647194-57647216 CCATGAGGGACTGTGCTATCTGG - Intergenic
1042622776 8:70724587-70724609 CCGTGAGGGACTGTGCTATCAGG - Intronic
1043532373 8:81165609-81165631 CCTTGAGGGACGGTGCAATCCGG + Intergenic
1044595326 8:93953466-93953488 CCATGAGGGATGGTGCTATCTGG - Intergenic
1046250637 8:111625503-111625525 TCTTGTAGGACCTTGGTATCAGG + Intergenic
1047369644 8:124245749-124245771 CCATGAGGGACGGTGCTATCTGG - Intergenic
1051235206 9:14992427-14992449 CCTTGAGGGAGGTTGCTTCCAGG - Intergenic
1051611708 9:18967943-18967965 TCGTGAAGGACAGTGCTATCTGG - Intronic
1051655525 9:19378082-19378104 ACTTTAAGGTCATTGCTATCTGG - Intronic
1052032418 9:23643800-23643822 CCCTGAAGGATGTGGCCATCTGG + Intergenic
1056130259 9:83578344-83578366 CCTTGTCTGACGTTGGTATCTGG - Intergenic
1058917225 9:109579238-109579260 CCATGAAGGATGTTGGTACCTGG + Intergenic
1186481019 X:9895981-9896003 GCTTGAAGGACGTGGCCCTCAGG - Exonic
1189039823 X:37530655-37530677 CCATGAGGGACAGTGCTATCTGG - Intronic
1189298962 X:39938238-39938260 CCTCCAAGAACGTTGCCATCAGG + Intergenic
1190505820 X:51125173-51125195 CCGTGAAGGATGGTGCTATCTGG + Intergenic
1191119684 X:56890552-56890574 CCTTGAGGGACTGTGCCATCAGG + Intergenic
1191194368 X:57705610-57705632 CCATGAGGGACCATGCTATCAGG + Intergenic
1191802654 X:65098676-65098698 CCATGAGGGACTGTGCTATCTGG + Intergenic
1192228396 X:69245850-69245872 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1193562606 X:83037735-83037757 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1194242503 X:91469725-91469747 CCTTGAGTGATGATGCTATCCGG + Intergenic
1195140039 X:101950101-101950123 CCATGAAGGACTGTGCTATCCGG + Intergenic
1195345015 X:103940907-103940929 CCATGAGGGACTGTGCTATCTGG - Intronic
1196466993 X:115982909-115982931 CCTTGAGGGACTTTGCTGTGTGG + Intergenic
1196476502 X:116092385-116092407 CCATGAGGGACTCTGCTATCAGG - Intergenic
1199924523 X:152448911-152448933 CCTTGGATGAGCTTGCTATCTGG - Intronic
1201608661 Y:15816062-15816084 CCTTGAGGGACTGTGCTATCTGG + Intergenic