ID: 1099745194

View in Genome Browser
Species Human (GRCh38)
Location 12:86692962-86692984
Sequence CTCTAGTTACAGAAGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099745194_1099745198 -7 Left 1099745194 12:86692962-86692984 CCATGGACCTTCTGTAACTAGAG 0: 1
1: 0
2: 2
3: 9
4: 90
Right 1099745198 12:86692978-86693000 ACTAGAGTGGCCTGACGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1099745194_1099745202 11 Left 1099745194 12:86692962-86692984 CCATGGACCTTCTGTAACTAGAG 0: 1
1: 0
2: 2
3: 9
4: 90
Right 1099745202 12:86692996-86693018 AGTGGTCCTTCACTGGGCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1099745194_1099745201 5 Left 1099745194 12:86692962-86692984 CCATGGACCTTCTGTAACTAGAG 0: 1
1: 0
2: 2
3: 9
4: 90
Right 1099745201 12:86692990-86693012 TGACGGAGTGGTCCTTCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 55
1099745194_1099745200 4 Left 1099745194 12:86692962-86692984 CCATGGACCTTCTGTAACTAGAG 0: 1
1: 0
2: 2
3: 9
4: 90
Right 1099745200 12:86692989-86693011 CTGACGGAGTGGTCCTTCACTGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099745194 Original CRISPR CTCTAGTTACAGAAGGTCCA TGG (reversed) Intronic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
904547460 1:31286842-31286864 CTCTAGTTAGAGATGGGCCAAGG - Intronic
904558749 1:31382814-31382836 CTCTAGTTGCAGTGGGTGCATGG - Intergenic
906512021 1:46415427-46415449 CTCTAGGTAGGGCAGGTCCACGG + Intergenic
909657596 1:78047989-78048011 TTTTAGTTACAGATGGTCCTGGG + Intronic
909873632 1:80777506-80777528 GTCAAGTTACACATGGTCCATGG - Intergenic
910661004 1:89672603-89672625 CTCTAGAAACAGAAAGACCAAGG + Intronic
911062668 1:93761480-93761502 CTGTGGTTTCAGCAGGTCCAGGG - Intronic
912244853 1:107950692-107950714 CTCATGTTACAGAAGGTGAAGGG + Intronic
915622196 1:157092643-157092665 CTCTAGTTAAGGAGGATCCAAGG + Exonic
915948558 1:160172157-160172179 ATCTGGCTTCAGAAGGTCCATGG + Intronic
918083825 1:181228350-181228372 CTCTAGTTATATAAGCTTCAGGG + Intergenic
1066787449 10:39020931-39020953 CTCTATTTACAGAATCTGCAAGG - Intergenic
1067525521 10:47036091-47036113 CTCCAGTCACAGGAGGTCCTTGG - Intergenic
1078422668 11:11224947-11224969 CTCTGGTCACAGAGGATCCAGGG - Intergenic
1079145680 11:17849554-17849576 CTGTAGATATAGAAGGTACAAGG - Intronic
1079171339 11:18098669-18098691 CTCTACTTACTAAAGGACCATGG + Intronic
1080931839 11:36819261-36819283 CTACAGTAAGAGAAGGTCCAGGG + Intergenic
1083103379 11:60333749-60333771 CTCTTGTTCCTGCAGGTCCATGG - Intergenic
1084429899 11:69105377-69105399 CTCACGTTACAAAAGATCCATGG - Intergenic
1085095901 11:73760626-73760648 CTCTAGTTCCACAATGTCCACGG - Exonic
1087214278 11:95478564-95478586 CCCTGGATACAGAATGTCCATGG + Intergenic
1089362122 11:117897935-117897957 CTCCTGTCCCAGAAGGTCCAGGG + Intergenic
1089714526 11:120345249-120345271 CTCTAGTTACAGTTGTTCAAGGG - Intronic
1090459703 11:126879812-126879834 CTCTGGAGACAGAAGGTTCAGGG - Intronic
1090463182 11:126910154-126910176 TTCTACTCCCAGAAGGTCCAGGG + Intronic
1093199729 12:16172187-16172209 CTCCCATTACAGTAGGTCCAGGG + Intergenic
1094601073 12:31909403-31909425 CTATAGTTATAGAAGGACAAGGG - Intergenic
1096722458 12:53533348-53533370 CTCTAGTTAGGGAAGGTATAGGG + Intronic
1097186480 12:57199081-57199103 CCCCAGTTACAGATGGTTCATGG - Intronic
1099019721 12:77388618-77388640 CTGTAGATTCAGCAGGTCCATGG - Intergenic
1099745194 12:86692962-86692984 CTCTAGTTACAGAAGGTCCATGG - Intronic
1104501700 12:129292481-129292503 CTGTAATTAGAGAAGGGCCAGGG + Intronic
1109765595 13:66891922-66891944 TTCTAGCTACAGAAGGTGAAGGG - Intronic
1113302375 13:109036142-109036164 ACCTTGTTAAAGAAGGTCCAGGG - Intronic
1114396109 14:22363143-22363165 ATCTAAGTACAGAAGGACCATGG + Intergenic
1124858931 15:33418940-33418962 CTTTATTTCCAGAAGCTCCAAGG + Intronic
1125117135 15:36107570-36107592 CTCTAGCTACAAAAGGAGCAAGG + Intergenic
1126808226 15:52374717-52374739 CTCTCCTTCCAGAAGCTCCAGGG - Intronic
1132869415 16:2109123-2109145 TTCTCGCTGCAGAAGGTCCAGGG - Exonic
1138320841 16:56110524-56110546 CTCTAGTTACAGATATTCTAAGG - Intergenic
1138716903 16:59034340-59034362 TTCAAGTTACAGAAGGACCATGG - Intergenic
1139532577 16:67549770-67549792 CTCTTGTTTCAGAAGGTTGACGG + Intergenic
1140712519 16:77691573-77691595 CTGTAGTTCCTGAAGGACCATGG - Intergenic
1142495167 17:302396-302418 TTCGATTTACACAAGGTCCAAGG + Intronic
1147190906 17:38737586-38737608 TCCTAGGTACTGAAGGTCCATGG - Intronic
1147744740 17:42688215-42688237 CTCCAGTTCCAGAAGGCCCCTGG + Intronic
1156399543 18:36728122-36728144 CTTCAGTTGCAGAGGGTCCAGGG + Intronic
1160778637 19:868113-868135 CTCTGGATGCAGATGGTCCAGGG + Exonic
1162457951 19:10797154-10797176 GTGTAGTTACAGAAGGGCCACGG - Intronic
1163026411 19:14515357-14515379 CTCTCGTTCCAGCAGGACCAAGG - Exonic
1163273714 19:16269322-16269344 CTCTAGGTACTGAGGTTCCAGGG - Intergenic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
927228493 2:20795533-20795555 CACTAGTTAAAGAAAGTCCAAGG + Intronic
932615446 2:73228449-73228471 CTCTTCTACCAGAAGGTCCAGGG + Exonic
932799159 2:74724124-74724146 CTCTAGCTTCTGAAGGTTCATGG + Intergenic
941946192 2:171100483-171100505 CTCATGTTACAGAAGGTCAAAGG - Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
1174047963 20:47747396-47747418 CTCTGGTTGCAGAAGTTCCTGGG + Intronic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1179209188 21:39312090-39312112 CTATAGTTACAGCAGTTGCAGGG - Intronic
953035696 3:39208942-39208964 CTTTTGTTACAGAGGGTCCTAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953941698 3:47104888-47104910 ATCTAGTTACAGCTGCTCCAAGG - Intronic
955494854 3:59520574-59520596 CTCTAGTACCTGAAGGGCCAGGG + Intergenic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
963811130 3:149777510-149777532 CTCCTGTTCCAGAAGGTGCATGG + Intronic
964167773 3:153729373-153729395 CTCTAGTTACAAAAGTTACTAGG + Intergenic
964289438 3:155160597-155160619 CTATAGTGAAAGAAGGTACACGG - Intronic
969894854 4:10294007-10294029 CTCTAGTTTCAGAAGGACCAAGG - Intergenic
982659640 4:158191554-158191576 GTCTAGTTACAGAAGGGTCTAGG + Intergenic
984047720 4:174822256-174822278 CTCTAGTTTCAGAGAGCCCATGG - Intronic
984760688 4:183360211-183360233 CTCTAGATACAGAAGGTTCAAGG - Intergenic
987070653 5:14334243-14334265 CTCCAGTTGCAGAAGGACCCAGG + Intronic
987253220 5:16121633-16121655 TTCTAATTACAGAAGGGCCAAGG + Intronic
997298376 5:132784149-132784171 CTCAAGTTTCATGAGGTCCAGGG + Intronic
997786204 5:136716218-136716240 CACTAGGTACACAAGGTCCAGGG - Intergenic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1002606908 5:180389105-180389127 CTCTAGTTCCAGCAGGTTGAAGG + Intergenic
1015726420 6:136304001-136304023 CTCAAGTGGCAGAAAGTCCAAGG - Intergenic
1017887683 6:158612311-158612333 CTATAGTTATAAAAGGACCAGGG + Intronic
1018569791 6:165196851-165196873 TCCTACTTACAGTAGGTCCATGG + Intergenic
1018738113 6:166704958-166704980 CTCTGGTTACAGAATTTCTAAGG + Intronic
1026973966 7:74485176-74485198 CTCTAGCTACAGATGCCCCAGGG + Intronic
1033511564 7:142064824-142064846 CTTTAGTTACAGGAGGTGAAGGG + Intronic
1033527562 7:142231744-142231766 CTCTGCTTCCAGAAGATCCAAGG - Intergenic
1034032258 7:147781058-147781080 CAATAGTTACTGAAGCTCCAGGG - Intronic
1035197606 7:157235590-157235612 ATATATTTACAGAAGATCCAGGG + Intronic
1035434770 7:158851016-158851038 CTCTAGTTAAAGAAGAGTCAAGG + Intergenic
1041647107 8:60264297-60264319 CTCTAGTAACAAAAGTTCTAGGG - Intronic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1052470408 9:28887285-28887307 CTCTAGTTATTGAAAGTCAAGGG + Intergenic
1055347249 9:75351898-75351920 ATCTAATTAGAGAATGTCCAAGG + Intergenic
1058858282 9:109088307-109088329 CTATAGTTTCAGTAAGTCCAGGG + Intronic
1185505387 X:629761-629783 CTTTATTTGCAGAAGGTCCTTGG + Intronic
1187851727 X:23597794-23597816 GTCCAGTTAGAGAAGGTTCAGGG + Intergenic
1193866051 X:86731347-86731369 CTCTAGTTTGAGCAGGTCCAAGG + Intronic
1194512246 X:94811267-94811289 CTCTAGTTCCAGCACTTCCATGG + Intergenic
1195649879 X:107273273-107273295 CTCTAGAGAGAGAAGCTCCAGGG + Intergenic
1197059110 X:122155483-122155505 ATCTAGTTTCAGAATGTACAAGG + Intergenic
1197745317 X:129928908-129928930 ATCTAGCTACAGGAGCTCCAGGG - Intronic
1199592772 X:149483187-149483209 CACAAGTTCCACAAGGTCCATGG + Exonic