ID: 1099746053

View in Genome Browser
Species Human (GRCh38)
Location 12:86706697-86706719
Sequence TAGAATCCCCAAATGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099746048_1099746053 -3 Left 1099746048 12:86706677-86706699 CCCTAAATTATGAATTGCCCTAG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG 0: 1
1: 0
2: 2
3: 10
4: 148
1099746049_1099746053 -4 Left 1099746049 12:86706678-86706700 CCTAAATTATGAATTGCCCTAGA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG 0: 1
1: 0
2: 2
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099746053 Original CRISPR TAGAATCCCCAAATGGCACA AGG Intronic
902298427 1:15484211-15484233 TAGCAAGACCAAATGGCACAGGG - Intronic
903220812 1:21868828-21868850 TAGAATCCCAAAATATCAGAGGG - Intronic
905769007 1:40625454-40625476 GTGAATCCCCAAATGTCAGATGG + Exonic
911564509 1:99447558-99447580 TATTTTCCTCAAATGGCACATGG + Intergenic
911668490 1:100582500-100582522 TGAAATCCCCAAATGGAAAAGGG + Intergenic
911812470 1:102300567-102300589 TGGAATCCCAAAATGGCACAAGG - Intergenic
916337055 1:163684667-163684689 CAGAATCCCCAAGTAGCAAAGGG - Intergenic
916788911 1:168107503-168107525 TAGAATCCCCAGGTGGCACAGGG - Intronic
919016466 1:192043782-192043804 TAAAATGCCCAAATGGCTTAAGG - Intergenic
920956480 1:210624218-210624240 TAGAGTCCCCAGGTAGCACAGGG - Intronic
922861996 1:228826907-228826929 CAGAATCAGCAAATGCCACAAGG + Intergenic
1062822462 10:545071-545093 TAGAAACTCAAAATGTCACAGGG + Intronic
1065944228 10:30592580-30592602 TAGAAGCCCCACATGCCACTCGG - Intergenic
1067450989 10:46381703-46381725 TAGAATTCCCAGGTGGCAGAAGG - Intronic
1067586254 10:47478048-47478070 TAGAATTCCCAGGTGGCAGAAGG + Intronic
1067684641 10:48459105-48459127 CAGAATCCCCAAACGGCCCTAGG + Intronic
1073253302 10:102134831-102134853 CTGAATTCCCAAATAGCACAGGG + Intronic
1074141454 10:110677118-110677140 TAGAATCCCGAGGTGGCATAGGG + Intronic
1074271937 10:111962594-111962616 TAGGATCCGCAAATGTCTCAAGG - Intergenic
1077956616 11:7027400-7027422 TAGAGTCCTCACATGGCAGAAGG + Intronic
1079531481 11:21459863-21459885 TACAATCAGCAAAGGGCACAGGG + Intronic
1080234098 11:30048915-30048937 TTTAATCCCAAAATGGTACAGGG + Intergenic
1081684880 11:45035327-45035349 TAGAAGCACCAAATGGCAAGGGG + Intergenic
1085225940 11:74921288-74921310 CAGAATCCCCAAATCACAGATGG + Exonic
1085808862 11:79662001-79662023 TAGAACCCAGAACTGGCACATGG - Intergenic
1088614216 11:111607284-111607306 TAAAATCCCCAAAATGCACATGG - Intronic
1090336544 11:125972005-125972027 TGAAATGCCCAAATGGCACAAGG + Intronic
1093477902 12:19574854-19574876 CACAATCCACACATGGCACATGG - Intronic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG + Intronic
1100853096 12:98733822-98733844 TAGAGTCCAGATATGGCACAGGG - Intronic
1103253621 12:119522047-119522069 AAGAAGTCCCAAATGCCACAGGG + Intronic
1104983889 12:132585961-132585983 TAGAAGCCCCACATGGCAGATGG - Intergenic
1106886979 13:34197425-34197447 TCAAATCCCCAGATGGCAAAGGG + Intergenic
1112248346 13:97754814-97754836 TAGCATCCCCACCTGGCAGAAGG + Intergenic
1112727613 13:102322416-102322438 TAGGATCCCCAAAAGCCTCAGGG - Intronic
1113154416 13:107302180-107302202 CAGAGTCCCCAGGTGGCACAGGG - Intronic
1118277407 14:64397658-64397680 AATAATTCTCAAATGGCACAGGG - Intronic
1119584411 14:75819344-75819366 TAGTATCCACAAATGGCAAAGGG - Intronic
1119974033 14:79005150-79005172 TAGAAACTCCAACTGCCACATGG - Intronic
1121441243 14:93950950-93950972 TGGAGTCCCCAAAGGGCACACGG - Intronic
1121549785 14:94790124-94790146 TTGTATCCCCACATGGCAGAAGG - Intergenic
1121828456 14:97029562-97029584 TAGAAGCAGCAAATGGCAAAGGG + Intergenic
1124570447 15:30858127-30858149 TTGAGTCCTCATATGGCACAAGG + Intergenic
1125318954 15:38461467-38461489 TAGAATCAGAAAATGGCACTAGG - Intronic
1127021811 15:54756576-54756598 TAAAGTCTCCAAAGGGCACATGG - Intergenic
1127580996 15:60339394-60339416 TCGAATCCCCAAATGGAAACAGG + Intergenic
1128825099 15:70707809-70707831 TACAATCCCCACAGTGCACAAGG - Intronic
1129834632 15:78694401-78694423 TAGAATCCGCAAAGGGAAAAGGG - Intronic
1130033473 15:80336773-80336795 TAGAATCTTCAAAGGGAACATGG + Intergenic
1131078529 15:89514618-89514640 TATAGCCCCCAAATGGCAAATGG + Intergenic
1135037874 16:19093381-19093403 CAGAGTCCCGAGATGGCACAGGG - Intergenic
1137943529 16:52712613-52712635 TGGAATCCCCAAGGGGCCCATGG + Intergenic
1141262936 16:82470142-82470164 CAGCATCCCCAGATGTCACATGG + Intergenic
1141980055 16:87544591-87544613 TGGAGGCCCCAAGTGGCACAGGG - Intergenic
1143659020 17:8313333-8313355 TACAATCCCCAACAGGCACTGGG + Intronic
1148712953 17:49695176-49695198 TAGAAGCGCCAAATGGAAAAGGG + Intergenic
1148813581 17:50310838-50310860 TAGAATCCCCCAATGGGAAGGGG - Intergenic
1150948480 17:69774907-69774929 TAGAATCTCCAAATGGAGCCTGG + Intergenic
1154506892 18:15049860-15049882 AAAAATCCTCAAATGGCAGATGG + Intergenic
1155786191 18:29903357-29903379 TAGAATTTGCAGATGGCACAAGG - Intergenic
1156655218 18:39276895-39276917 AAGCAACCACAAATGGCACATGG + Intergenic
1159579296 18:70217273-70217295 TAAAATTCCCAAATCCCACATGG - Intergenic
1161528179 19:4770367-4770389 TGGGTTCCCCAAATGTCACATGG - Intergenic
1162823530 19:13237377-13237399 TTCACCCCCCAAATGGCACAGGG + Intronic
1167378284 19:49123899-49123921 TAGAATGCCAAAGTGGCAGATGG - Intronic
925201525 2:1970717-1970739 TAGAATCCCCACATGGATGAGGG + Intronic
925321568 2:2974189-2974211 TAGAATGACCAGATTGCACAGGG - Intergenic
926196352 2:10765783-10765805 GAGAATCCCAAATTGGCACATGG - Intronic
928099889 2:28430799-28430821 CAGAATCCTCCAATGGCTCATGG - Intergenic
932990991 2:76787259-76787281 TAGAATGCACAATTGGCATAAGG + Intronic
933889415 2:86753267-86753289 TAGAATCCCCAAATTTCAGCAGG - Intronic
936395647 2:112126493-112126515 TTGAATCCTCACATGGCAGAAGG - Intergenic
940648829 2:156419966-156419988 TAGAATACACAAATGTCACTTGG + Intergenic
946117913 2:217479687-217479709 TAGAAAACCAAAATGTCACACGG + Intronic
946328874 2:218998903-218998925 CAAAATCCCCAAATGGCGCCAGG - Intergenic
1170894332 20:20400211-20400233 TAACATCTCCAAATGGCCCAAGG + Intronic
1173317103 20:41954917-41954939 TGGCATCCCAACATGGCACATGG - Intergenic
1176790979 21:13319241-13319263 AAAAATCCTCAAATGGCAGATGG - Intergenic
1177990812 21:28034125-28034147 AAAAATCCTCAAATGGCAGATGG + Intergenic
1179116290 21:38495707-38495729 TAGACTTCCCAAATTGCAGATGG + Intronic
1180762425 22:18220306-18220328 TAGTGTTCCCAAATGGCCCAGGG - Intergenic
1180773243 22:18404302-18404324 TAGTGTTCCCAAATGGCCCAGGG + Intergenic
1180804596 22:18653851-18653873 TAGTGTTCCCAAATGGCCCAGGG + Intergenic
1180806152 22:18715559-18715581 TAGTGTTCCCAAATGGCCCAGGG - Intergenic
1181192339 22:21151235-21151257 TAGTGTTCCCAAATGGCCCAGGG + Intergenic
1181217100 22:21341340-21341362 TAGTGTTCCCAAATGGCCCAGGG - Intergenic
1203235073 22_KI270731v1_random:145284-145306 TAGTGTTCCCAAATGGCCCAGGG + Intergenic
953887491 3:46723778-46723800 TAGAAACTTCTAATGGCACAAGG + Intronic
956040687 3:65141975-65141997 AAAAATCCCCAAATAGCAGAGGG - Intergenic
956519176 3:70084841-70084863 TAGTATCCCCAATTTGCAGATGG + Intergenic
958557080 3:95692987-95693009 TGGAATCCAGACATGGCACATGG + Intergenic
959893198 3:111579617-111579639 AAGAATCCCAAGGTGGCACACGG + Intronic
961606692 3:128100788-128100810 CCAAGTCCCCAAATGGCACAGGG + Intronic
961869555 3:129977545-129977567 AAGACTCCCCAAGTGGGACAGGG + Exonic
966042884 3:175513277-175513299 TAAAATCCACATATGGCTCATGG - Intronic
966900710 3:184482051-184482073 TAGAGTCCCAAGGTGGCACAGGG + Intronic
968056268 3:195694268-195694290 CATAATCCCCAAAAGGGACAAGG - Intergenic
969271260 4:6104937-6104959 CAGAATCCACAAATGCCCCAAGG + Intronic
969587993 4:8105625-8105647 GTGAATCTCCAAATGGCCCAGGG + Intronic
969971648 4:11054103-11054125 TGGAATCCACAAGTGGCACAAGG + Intergenic
971048070 4:22828594-22828616 TCGAACCCACAAAAGGCACATGG - Intergenic
971775584 4:30960213-30960235 TAGCATCTCCAAATTGCACTGGG - Intronic
971973670 4:33654687-33654709 TTGAATCCCCAAGTGCAACAAGG + Intergenic
974083158 4:57233229-57233251 AACAATCCCAAAATGGCAAAAGG + Intergenic
975033050 4:69647322-69647344 TAGAATCTCCAAATGGTTGAAGG + Exonic
977453366 4:97226408-97226430 TAGAATTCCCAAATAATACAAGG - Intronic
978094868 4:104763611-104763633 ATCAATCCCCAAATGGCAGATGG + Intergenic
982113461 4:152077097-152077119 TAGAGTCCTCACATGGCAGAAGG - Intergenic
982330392 4:154175858-154175880 TAGAATCAACAAATGGCTCATGG + Intergenic
983495075 4:168434535-168434557 TTGGATCCCTAAATGCCACAGGG + Intronic
985956065 5:3267245-3267267 AACAATCCCCAAAGGACACATGG + Intergenic
986481166 5:8189639-8189661 CAGAATCCACAAATAGCAAAAGG + Intergenic
987210949 5:15682706-15682728 TAGAATTCCCAAAGGGCTCTTGG + Intronic
989799421 5:45518450-45518472 AAGAATCTCCTGATGGCACAGGG + Intronic
992997201 5:82345539-82345561 GAGACTCCCCAAAGGGGACAAGG + Intronic
993000190 5:82373287-82373309 ATCAATCCCCACATGGCACAGGG + Intronic
994309369 5:98250069-98250091 TAAAATGCCCAACTGACACAAGG + Intergenic
995537074 5:113147354-113147376 TAGCATCACCACATTGCACAGGG - Intronic
996102582 5:119459662-119459684 TAGAGTCCCGAGATGGCACAGGG + Intronic
999843220 5:155451067-155451089 TATTATTCCCAAATGGCAGACGG - Intergenic
1000381798 5:160636213-160636235 TAGAAGCCCCCAAGGGCACTGGG + Exonic
1001443845 5:171767474-171767496 TAGATTCCACAAAAGGCTCATGG - Intergenic
1001621774 5:173092471-173092493 TAGTATTGCCAAGTGGCACATGG + Intronic
1006404571 6:33837371-33837393 TAGAGTCCCCAGAAGGCACGTGG - Intergenic
1006698099 6:35948920-35948942 CAGCATCCCCACATGGCAGAAGG - Intronic
1008173864 6:48242385-48242407 TATTATCCCCACATGTCACAGGG + Intergenic
1008387411 6:50908073-50908095 AATAATCCCCAAATGCCACGAGG + Intergenic
1011707812 6:90020482-90020504 CAGAATCCCAAGGTGGCACAGGG - Intronic
1012318025 6:97804737-97804759 TAGAATGCCCAAATATAACATGG + Intergenic
1014240132 6:119008184-119008206 TAGATGCCCCAAATGCCATAAGG - Intronic
1014257632 6:119179099-119179121 TATAATCCAGAAATGACACAGGG + Exonic
1014617285 6:123618719-123618741 TAGAATGCCCAAAAGATACACGG - Intronic
1015331388 6:131983534-131983556 CAGAATCCTGAGATGGCACAGGG + Intergenic
1015839266 6:137459551-137459573 CAGAATCATCAAATGGCCCAAGG - Intergenic
1015977944 6:138810348-138810370 TAGGATCTCCGAATGGAACAAGG + Intronic
1018504175 6:164445893-164445915 TAGCATACCCTAATGTCACAGGG + Intergenic
1020537107 7:9413517-9413539 TCGAATCACCAAATGCCACATGG + Intergenic
1029049633 7:97671039-97671061 TAGAATCACCACATTTCACAGGG + Intergenic
1038975900 8:32695697-32695719 CAGATTCATCAAATGGCACATGG + Intronic
1039376360 8:37038260-37038282 AAGAGTCCCCAGATGGCAGATGG + Intergenic
1041535868 8:58925009-58925031 AAGCAGCCCCAGATGGCACATGG + Intronic
1043486841 8:80706035-80706057 CAGACTTCCCAAATGACACAGGG - Intronic
1043983870 8:86671292-86671314 TAGAATCCTCAAATAGCAAGTGG + Intronic
1051364849 9:16314647-16314669 GAGAACCCCCAAATGTGACATGG - Intergenic
1051433462 9:17004974-17004996 TAGAAACCCCAGATACCACATGG + Intergenic
1055616886 9:78082249-78082271 CAGCATCCCCACATGGCAGAAGG - Intergenic
1055806625 9:80102857-80102879 TAAAAGCCCCAAATGGGAAATGG + Intergenic
1056279947 9:85031314-85031336 TGGAGTCCTCAAATTGCACAGGG - Intergenic
1056423333 9:86451779-86451801 TTGAGTCCTCAAATGGCAGAAGG + Intergenic
1059467185 9:114476407-114476429 TTCAGTCCCCGAATGGCACATGG + Intronic
1060883969 9:127137570-127137592 AAGAATCCTGAAATGGCTCATGG - Intronic
1185963783 X:4576895-4576917 CAGAATCCCGAGGTGGCACAGGG - Intergenic
1186170312 X:6869795-6869817 TACACTCCCCAAATAGTACAAGG - Intergenic
1186788285 X:12973614-12973636 TAGACTCCCAACATGGAACAGGG + Intergenic
1189360652 X:40348209-40348231 TGGAATCCCAAAATGACAGATGG - Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1196206445 X:112945600-112945622 TAGAATCCTCAAATGAGAAAGGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198777581 X:140197172-140197194 TATTATCCCCAAATTGCAGATGG - Intergenic
1199726102 X:150582753-150582775 TAGAGGCTCCAGATGGCACATGG + Intronic