ID: 1099747933

View in Genome Browser
Species Human (GRCh38)
Location 12:86731615-86731637
Sequence GGAAACAAAGTGCCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 1, 2: 14, 3: 72, 4: 466}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099747933 Original CRISPR GGAAACAAAGTGCCACAAGC TGG (reversed) Intronic
902722093 1:18310671-18310693 TGTAACAAAATGCCACAAACTGG + Intronic
902832751 1:19028359-19028381 GGAAACGAAGTGCCAGAGGGTGG + Intergenic
903473674 1:23605087-23605109 TATAACAAAGTACCACAAGCTGG - Intronic
904869376 1:33607032-33607054 CCAAACAAAGTGCCATAATCAGG + Intronic
905081141 1:35321730-35321752 GGAAAAAAAGTGTCATAAACTGG + Intronic
905622933 1:39464509-39464531 GAAAACAAAATCCAACAAGCAGG - Intronic
905844432 1:41216491-41216513 GGAAACCAAGAGCCACAACTAGG + Intronic
906115806 1:43356398-43356420 TGTAACAAAGTACCACAAACTGG - Intergenic
907820068 1:57958615-57958637 ATAAACAAAGTGCCACTAACTGG + Intronic
907830657 1:58061272-58061294 TGAAACAAAGTGCCACAAACCGG + Intronic
908592593 1:65650189-65650211 TGTAACAAAGTGCCACAGACTGG + Intergenic
908755297 1:67464204-67464226 GGAAAGAAAGTACCAGAAGGAGG - Intergenic
909358853 1:74739590-74739612 GGAAAGAAGGTGCCAGAAGGAGG + Intronic
909491923 1:76235694-76235716 GGTAACAAGGTGCCACAAACTGG + Intronic
910552368 1:88490143-88490165 CATAACAAAGTGCCACAAACTGG - Intergenic
910882895 1:91938534-91938556 CGTAAGAAAGTACCACAAGCTGG - Intergenic
911154555 1:94625379-94625401 TATAACAAAGTGCCACAAGCTGG + Intergenic
911468637 1:98287019-98287041 AGAAACAAAGTGCCACTTGCAGG + Intergenic
912366293 1:109136517-109136539 TGTAACAAAGTGCCACAGACTGG - Intronic
912582294 1:110731396-110731418 TGTAACAAAGTACCACAAACTGG - Intergenic
912583876 1:110744181-110744203 GGACTCAAAGTGTCACAAGATGG + Intergenic
913155917 1:116098259-116098281 TGAAACAAAGTGCCAAATGACGG - Intergenic
916271442 1:162946936-162946958 GGTAACAAATTCCCACAAACTGG - Intergenic
916324261 1:163539592-163539614 GGAAACAAAGGTTCACAAACGGG + Intergenic
917294861 1:173507887-173507909 TGTAACAAAGTACCACAAACTGG - Intronic
917522436 1:175759400-175759422 GGCAGCAAAGTACCACAAACCGG + Intergenic
918243477 1:182639984-182640006 TGTAACAAAGTGCCACAGACTGG - Intergenic
918559565 1:185848358-185848380 GGGAACAAAGTGTGTCAAGCAGG - Intronic
919156122 1:193767818-193767840 GGTAACAAAGTACCACAAACTGG - Intergenic
920178823 1:204120145-204120167 TGAAACAAAGTGCCATAAACTGG - Intronic
920740274 1:208575370-208575392 TGTAACAAAGTACCACAACCTGG + Intergenic
921445670 1:215244187-215244209 AGAAGCAAAGTGAAACAAGCAGG + Intergenic
921716460 1:218422043-218422065 AGTAACAAAGTACCACAAACTGG - Intronic
921949036 1:220909855-220909877 GGAAACAAAGTGCCAAAACTGGG - Intergenic
923952923 1:238980310-238980332 GGTAACAAAGTACCACAGACTGG - Intergenic
924421500 1:243914234-243914256 AGTAACAAAGTACCACAAACTGG - Intergenic
924493316 1:244561469-244561491 CGTAACAAAGTACCACAAACTGG + Intronic
924863653 1:247954089-247954111 GGAAACAAATTGATACAAGATGG - Intronic
1062767842 10:79388-79410 CGTAACAAAGTGCCACAAAATGG - Intergenic
1062895637 10:1101197-1101219 CATAACAAAGTGCCACAGGCAGG + Intronic
1062991004 10:1817838-1817860 TATAACAAAGTGCCACAAACTGG + Intergenic
1065946468 10:30609525-30609547 GGATACAAAGAGCCAGATGCTGG + Intergenic
1066247256 10:33595498-33595520 GGAAACAGAATGCCCCAAGGGGG - Intergenic
1066454175 10:35558842-35558864 GGTAACAAAGTCCCACAGACTGG - Intronic
1066589742 10:36981540-36981562 GGTAACAAAGTACCACAAACTGG - Intergenic
1067102541 10:43343387-43343409 GGGGACAAAGTGCCACCAACTGG - Intergenic
1067354899 10:45515022-45515044 GGAAACAAACTGCTTCAAGGAGG + Intronic
1067666854 10:48286396-48286418 GAAAACATCCTGCCACAAGCAGG - Intergenic
1068939475 10:62666692-62666714 GTAAACAAAGTACCACAAATTGG - Intronic
1069512264 10:69051260-69051282 TCCAACAAAGTGCCACAAACTGG + Intergenic
1069601752 10:69712411-69712433 GGAAAGAAAGGGCGAAAAGCCGG - Intergenic
1069635240 10:69921035-69921057 GGTAACAAAGTACTACAGGCTGG + Intronic
1069760364 10:70806449-70806471 TGTAACAAAGTGCCACAAACTGG + Intergenic
1070032976 10:72694707-72694729 GGAACAAAAGTGGCACAAACTGG - Intronic
1071315036 10:84387456-84387478 TGAAATAAAGTGCCAAAAGTAGG - Intronic
1071974784 10:90944452-90944474 CGTAACAAAGTACCACAAACAGG + Intergenic
1072757064 10:98028658-98028680 GGGAAGAAAGAGCAACAAGCAGG + Intronic
1074847189 10:117408701-117408723 TGTAACAAACTGCCACAAACTGG - Intergenic
1075192666 10:120325190-120325212 TGGAACAAATTGCCACAAACTGG + Intergenic
1076076831 10:127540096-127540118 GCCACCAAAGGGCCACAAGCAGG - Intergenic
1076588062 10:131563511-131563533 TGTAACAAAGTGCCACAGGGTGG + Intergenic
1078206409 11:9233851-9233873 GGCAACAAATTACCACAAACTGG - Intronic
1078274036 11:9825437-9825459 CGTAACAAAGTGCCACAAATTGG - Intronic
1078990958 11:16645851-16645873 TGTAACAAAGTACCACAAACTGG - Intronic
1079323052 11:19468274-19468296 TGTAACAAAGTGCCACAAACTGG + Intronic
1081461580 11:43277178-43277200 TGTCACCAAGTGCCACAAGCTGG - Intergenic
1082698208 11:56396919-56396941 TGAAACAAAGTGCCAGATGAAGG - Intergenic
1083355884 11:62065786-62065808 CGTCACAAAGTGCCACAAGCTGG + Intergenic
1083473848 11:62902845-62902867 CGTAACAAAGTACCACAAACTGG - Intergenic
1084073705 11:66755630-66755652 TGTAACAAAGTACCACAAACTGG + Intronic
1084448724 11:69219550-69219572 GGAAACAAAGTGCCTCACGTAGG + Intergenic
1084684065 11:70683511-70683533 TGTAACAAATTGCCACAAACCGG + Intronic
1085636267 11:78161700-78161722 TGTAACAAAGTGCCACAGCCTGG + Intergenic
1085922904 11:80980423-80980445 TGAAACAAAGCATCACAAGCTGG - Intergenic
1086587247 11:88467911-88467933 CAAAACAATGTGACACAAGCAGG - Intergenic
1086999489 11:93400181-93400203 TGTAACAAAGTACCAAAAGCTGG + Intronic
1087132888 11:94684123-94684145 CATAACAAAGTGCCACAAACTGG + Intergenic
1087582827 11:100080630-100080652 GGAAACAAAGGGACAAAAACAGG - Intronic
1087791213 11:102407862-102407884 AGAAACAAAGTACCAGAAACTGG - Intronic
1087854882 11:103079541-103079563 GGCAACATAGTGAGACAAGCTGG + Intronic
1088073642 11:105820185-105820207 GGAAACAAAGTGCCACAGATTGG - Intronic
1088372981 11:109111620-109111642 GTAAAAAAAGTCCCACAAACTGG - Intergenic
1088565956 11:111173324-111173346 GGAATCAAATGGCCACAACCTGG + Intergenic
1089187213 11:116627426-116627448 TGTAACAAAGTACCACAAACTGG + Intergenic
1089257991 11:117204097-117204119 GGAAAAAAAGTGCAACAGGAAGG + Intronic
1089489053 11:118870407-118870429 GGAAAGAAGGGGCCCCAAGCTGG - Intergenic
1091041310 11:132284223-132284245 GGTAACAAAGTACCACAGCCTGG + Intronic
1091194163 11:133717793-133717815 TGTAACAAAATGCCACAAACTGG + Intergenic
1091891484 12:4058488-4058510 TGTAACAAATTGCCACAAACTGG + Intergenic
1093111184 12:15154154-15154176 CTCAACAAAGTACCACAAGCTGG - Intronic
1093926044 12:24909471-24909493 AGTAACAAAGTGCCACAAACTGG + Intronic
1093974874 12:25410588-25410610 TGTAACAAAGTACCACAAACTGG - Intronic
1094318684 12:29160580-29160602 TGTAACAAAGTACCACAAACTGG + Intronic
1095345698 12:41146776-41146798 TGTAACAAGGTGCCACAAACTGG - Intergenic
1096670517 12:53195802-53195824 GGAACCAAGGTTCCACCAGCTGG + Intronic
1096871341 12:54594253-54594275 TGTAACAAAGTGCCACTAACTGG + Intergenic
1096906139 12:54937630-54937652 GGAAAAAAAGTGGGATAAGCTGG + Intergenic
1098131781 12:67358710-67358732 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1098935872 12:76478787-76478809 GTAAACAAAGTGTAACAGGCCGG + Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1100131526 12:91499736-91499758 TGGAACAAAGTGCCACAAACTGG - Intergenic
1101386770 12:104265433-104265455 AGATACAAAGTACCAGAAGCGGG - Intronic
1101395107 12:104340404-104340426 TGTAACAAAGTACCACAAACTGG + Intronic
1101795868 12:107973128-107973150 AGTGACAAAGTGCCACAAACTGG + Intergenic
1101833212 12:108275340-108275362 CAAATCAAAGTGCCACAAACCGG + Intergenic
1101911974 12:108866834-108866856 TGTAACAAAGTGCCACAAACTGG - Intronic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1101992646 12:109499883-109499905 AGAAACAAAACACCACAAGCTGG - Intronic
1102259005 12:111432078-111432100 GGACACAAAGTGAAAAAAGCAGG - Intronic
1102302030 12:111778057-111778079 GGAAACAGAGTGCCCCAGGAAGG - Intronic
1102722817 12:115032831-115032853 CGTAACAAATTGCCACAAACTGG - Intergenic
1103033912 12:117641014-117641036 TGTAACAAAGTACCACAAACTGG + Intronic
1103061847 12:117864541-117864563 TGTAACAAAGTACCACAAGTTGG + Intronic
1103389076 12:120557258-120557280 TGAAACAAAATGCCACCAGAAGG - Intronic
1103859062 12:123997336-123997358 TGTAACAAAGTACCACAAGCTGG + Intronic
1103952163 12:124557241-124557263 GTAAACAAAGCTCCACACGCCGG + Intronic
1104170166 12:126272982-126273004 TACAACAAAGTGCCACAAACTGG - Intergenic
1104571858 12:129933122-129933144 CGTAACAAAGTCCCAGAAGCTGG + Intergenic
1104916326 12:132266701-132266723 TGTAACAAGGAGCCACAAGCAGG - Intronic
1105249963 13:18689562-18689584 TGTAACAAAGTACCACAAACCGG - Intergenic
1105443976 13:20436848-20436870 TGAAACAAAGGGCCCCAAGCAGG + Intronic
1106240227 13:27906197-27906219 GGAAACTTAATGCAACAAGCTGG - Intergenic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1107268270 13:38583334-38583356 GTAAACAATGTGCCAACAGCCGG - Intergenic
1107753754 13:43597331-43597353 GGAAACAAAGGGCCACTGACAGG + Intronic
1108172831 13:47760954-47760976 GGAAACAAACTGCCACATTGTGG - Intergenic
1108548560 13:51520702-51520724 CAAAACAAACTGCCACAAGCTGG + Intergenic
1108736218 13:53285671-53285693 TGTAACAAAGTGCAACAAACTGG - Intergenic
1109142927 13:58737973-58737995 TGCAACAAAGTGCCACAAAATGG - Intergenic
1109287525 13:60427902-60427924 GGTAGCAAATTACCACAAGCTGG + Intronic
1109804542 13:67421205-67421227 TGTAACAAAGTTCCACAAACTGG - Intergenic
1109957733 13:69590659-69590681 TGTAACAAAGTGCCATAAACTGG + Intergenic
1110161867 13:72388050-72388072 TGTAACAAAGTGCCACAAACTGG - Intergenic
1110550348 13:76805048-76805070 CACAACAAAGTGCCACAAACTGG + Intergenic
1110552396 13:76824278-76824300 TGCAACAAAGTGCCACTATCTGG + Intergenic
1111360929 13:87175332-87175354 TGTAACAAAGTTCCACAAACTGG + Intergenic
1111622946 13:90747547-90747569 TGTAACAAAGTACCACAAACTGG + Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1112588867 13:100745502-100745524 CATAACAAAGTGCCACAAGCTGG - Intergenic
1112770847 13:102793144-102793166 CGTAACAAAGTGCTACAAACTGG - Intronic
1113223692 13:108134953-108134975 TGTAACAAAGTACCACAAACTGG - Intergenic
1113541216 13:111111503-111111525 CGTAACAAAGTCTCACAAGCTGG - Intergenic
1113615136 13:111675235-111675257 TGTAACAAAGTGCCACAAACAGG + Intergenic
1113620603 13:111760148-111760170 TGTAACAAAGTGCCACAAACAGG + Intergenic
1117726115 14:58675959-58675981 GATAACAAAGTGCCAGTAGCTGG - Intergenic
1118501370 14:66365481-66365503 AGAAACAAATTGCCAGCAGCAGG + Intergenic
1119370762 14:74140223-74140245 GTAGACAAAGTGCTACAAGAAGG - Intronic
1120030481 14:79635463-79635485 TGTAACAAAGTGTCACAAACTGG + Intronic
1120092075 14:80343634-80343656 TGTAACAAAGTGCCACAAACTGG + Intronic
1120877994 14:89392384-89392406 TGTAACCAAGTGCCACAAGCCGG + Intronic
1121078745 14:91090595-91090617 GCAAACTAAGAGCCACTAGCAGG + Intronic
1121255383 14:92526797-92526819 CATAACAAAGTGCCACAAACTGG + Intronic
1121624250 14:95372944-95372966 GGCAACAAAGTACCACAGACTGG - Intergenic
1121754799 14:96393377-96393399 GGTAACCAATTGCCACAAACTGG + Intronic
1121960301 14:98253463-98253485 GGAAAGAATGTACCAGAAGCAGG + Intergenic
1122730567 14:103794165-103794187 CGTAACAAAGTGCCACAGACTGG - Intronic
1122943924 14:104996437-104996459 AGGAAGAAAGTGCCAAAAGCTGG + Intronic
1125167996 15:36732355-36732377 GGAATCAAGGTGCAACAAACAGG - Intronic
1125854542 15:42936372-42936394 TGAAAAACAGTGCCACAGGCTGG - Intergenic
1126267852 15:46775442-46775464 CGATAGAAAATGCCACAAGCGGG - Intergenic
1126706473 15:51410555-51410577 GGAAAGGAGGTGCCAGAAGCAGG - Intergenic
1126740522 15:51772320-51772342 AGAAACAAAGAGTCAAAAGCTGG + Intronic
1127368114 15:58310212-58310234 TGAAACAAAGTGCCATAAAGTGG - Intronic
1127474214 15:59317341-59317363 TGGAACAAGGTGCCAAAAGCTGG + Intronic
1127616356 15:60690031-60690053 GGTAACAAAGTGCCACAAACTGG - Intronic
1129775766 15:78235314-78235336 TGTAACAAAGTTCCACAAACTGG + Intronic
1130671177 15:85914250-85914272 GGTAACAGAGTTCCACAAACTGG + Intergenic
1130676914 15:85960972-85960994 TATAACAAAGTACCACAAGCTGG - Intergenic
1130873815 15:87994631-87994653 TGTAACAAAGTGCCACAAACTGG - Intronic
1131392207 15:92058670-92058692 AGAAACAAAGTACCATAAACTGG + Intronic
1131805343 15:96116154-96116176 GAAAACAAAGTGACAGAAACAGG + Intergenic
1132288187 15:100681004-100681026 GGAAGGAGAGTCCCACAAGCAGG - Intergenic
1132456776 16:28481-28503 CGTAACAAAGTGCCACAAAATGG - Intergenic
1133268001 16:4596123-4596145 CGAGACAAATTACCACAAGCAGG + Intronic
1133618149 16:7499073-7499095 GAAAACAAAGAACCACAAACTGG + Intronic
1134855051 16:17511526-17511548 TGTAACAAAGTCCCACAAGCTGG + Intergenic
1135178485 16:20252405-20252427 TGTAACAAATTGCCACAAACTGG + Intergenic
1135685934 16:24498437-24498459 TGAAACAAAGTACCACCACCTGG - Intergenic
1136243792 16:28961440-28961462 TGTAACAAAGTACCACAAGTTGG + Intronic
1137952887 16:52800300-52800322 TGTAACAAAGTACCACAGGCCGG - Intergenic
1138425712 16:56931055-56931077 CATAACAAAGTGCCACAAACTGG - Intergenic
1138475445 16:57268219-57268241 CGTAACAAAGTTCCACAAACTGG - Intronic
1139139625 16:64245338-64245360 GAAAACAAAGTTCAACAAGTGGG + Intergenic
1140227453 16:73090035-73090057 GGAAAAAAAGTGCCTCAGCCTGG - Intergenic
1141314605 16:82950058-82950080 TATAACAAAGTGCCACAAACTGG + Intronic
1141480191 16:84301257-84301279 TGCAACAAAATGCCACACGCTGG - Intronic
1141650688 16:85391368-85391390 CGTAACAAAGTACCACAAACTGG + Intergenic
1142072261 16:88097611-88097633 TGCAGCAAAGTGCCACAAACCGG - Intronic
1143710436 17:8730812-8730834 AGAAAGAAAGGGTCACAAGCAGG + Intronic
1143993016 17:10982764-10982786 TGTAACAAAGTACCACAGGCTGG + Intergenic
1144016756 17:11203600-11203622 AGAAACAAAGTGCCACCCACTGG + Intergenic
1144263128 17:13542586-13542608 CATAACAAAGTGCCACAGGCTGG - Intronic
1145095847 17:20025327-20025349 TGGAACAAAGTACCACAAACTGG - Intronic
1146852795 17:36237914-36237936 TGCAACAAAGTACCACAAACTGG - Intronic
1146868706 17:36361806-36361828 TGCAACAAAGTACCACAAACTGG - Intronic
1147083106 17:38041954-38041976 TGCAACAAAGTACCACAAACTGG - Intronic
1147099049 17:38165927-38165949 TGCAACAAAGTACCACAAACTGG - Intergenic
1147651837 17:42067310-42067332 CATAACAAAGTGCCACAGGCTGG - Intergenic
1149000336 17:51750948-51750970 GGAAACACACTGGCACAAGTAGG + Intronic
1149349597 17:55773652-55773674 AGAAGGAAAGCGCCACAAGCTGG - Intronic
1149838582 17:59937387-59937409 TGCAACAAAGTACCACAAACCGG + Intronic
1150063373 17:62088157-62088179 GGAAACAAAATTCTAGAAGCTGG - Intergenic
1150080585 17:62234970-62234992 TGCAACAAAGTACCACAAACTGG - Intergenic
1150710830 17:67529617-67529639 TGTAACAAAGTGCCACAAACTGG + Intronic
1150841043 17:68605595-68605617 TGTAACAAAGTGCCACAAGCTGG - Intergenic
1151951144 17:77354797-77354819 GGACGCAAAGTGCAACAAGCAGG - Intronic
1151958233 17:77391314-77391336 TGTAACAGAGTGCCACAACCTGG + Intronic
1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG + Intronic
1152478028 17:80531086-80531108 TGTAACAAAGTACCACAAACTGG - Intergenic
1152960667 18:78720-78742 CGTAACAAAGTGCCACAAAATGG - Intergenic
1154438863 18:14369334-14369356 TGTAACAAAGTACCACAAACTGG + Intergenic
1155987259 18:32243380-32243402 TGTAACAAAATGCCACAAACTGG - Intronic
1157130904 18:45006391-45006413 AGTAACCAAGTTCCACAAGCTGG + Intronic
1158415683 18:57247923-57247945 TGTAACAAAGTACCACAAACTGG + Intergenic
1158483342 18:57842550-57842572 TGTAACAAAGTTCCACAAACTGG + Intergenic
1158629041 18:59096134-59096156 TGTAACCAAGTGCCACAAACTGG - Intergenic
1158827114 18:61235142-61235164 CGTAACAAAGTACCACAAACTGG + Intergenic
1158847587 18:61461299-61461321 CGTAACAAAGTACCACAAGCTGG + Intronic
1158866585 18:61643611-61643633 TGTAACAAAGTGCCACAAAGTGG - Intergenic
1159118049 18:64137366-64137388 CCTAACAAAGTGCCACAAACTGG - Intergenic
1159325434 18:66909933-66909955 CATAACAAAATGCCACAAGCTGG + Intergenic
1159456805 18:68669541-68669563 CATAACAAAGTGCCACAAACTGG + Intergenic
1159643707 18:70892493-70892515 GGTAACAAAGTACCATGAGCTGG - Intergenic
1160389326 18:78518321-78518343 TGTAGCAAAGTGCCACAAACTGG - Intergenic
1161228596 19:3160647-3160669 CGTAACAAAGTACCACAAACTGG + Intronic
1161584692 19:5098898-5098920 TGAAACAAAATACCATAAGCTGG - Intronic
1162118456 19:8445943-8445965 GGAGTCAAAGAGCCCCAAGCAGG - Intronic
1162422657 19:10574704-10574726 GGGAACAAGGTGGCACAGGCCGG + Intronic
1163532951 19:17861399-17861421 AGATACAAAGTACCAGAAGCGGG - Exonic
1165643980 19:37417572-37417594 TGAAACAAAGTACCACAAGCTGG - Intronic
1166158980 19:40937517-40937539 AGAAACAGAGTGACACAGGCAGG + Intergenic
1168233825 19:55049463-55049485 CGTAACAAAGTGCCACAGACAGG + Intronic
925039576 2:720937-720959 GGAATAAAAGTGTCCCAAGCGGG - Intergenic
926606268 2:14901856-14901878 GGAAGGACAGTTCCACAAGCAGG + Intergenic
927326543 2:21811790-21811812 GGTTACAAAATGCCACAAACTGG - Intergenic
928835395 2:35538082-35538104 AGAAACAAAGTGGCGCAAGAGGG + Intergenic
929459480 2:42091749-42091771 TATAACAAAGTGTCACAAGCTGG - Intergenic
929785659 2:44989117-44989139 AGAAAAAAAGTGACAGAAGCTGG - Intergenic
929815963 2:45231848-45231870 TGTAACAAAATGCCATAAGCTGG + Intergenic
929918956 2:46158787-46158809 GGAAAAAAAGTGCCAGTAGGTGG - Intronic
929957407 2:46469051-46469073 GGAAACAAATTTCCACCAGAAGG - Intronic
931636171 2:64342369-64342391 AGTAACAAAGTGCCACAGACTGG - Intergenic
931898739 2:66763998-66764020 GATAACAAAGTACCACAAGTTGG - Intergenic
933261198 2:80133365-80133387 CGTAACAAAGTGCCACAAACTGG - Intronic
933481759 2:82867060-82867082 TATAACAAAGTGCCACAAACTGG + Intergenic
933514992 2:83289373-83289395 TGAAACAAAATACCACAAACTGG - Intergenic
933761343 2:85674320-85674342 TGGAACAAAGCACCACAAGCTGG - Intergenic
933993737 2:87652312-87652334 TGTAACAAAATGCCATAAGCTGG + Intergenic
936300126 2:111298571-111298593 TGTAACAAAATGCCATAAGCTGG - Intergenic
936442054 2:112563027-112563049 AGAAAGAAATTGTCACAAGCTGG - Intronic
936678418 2:114741943-114741965 TGGAACAAAGTACCACAAACTGG - Intronic
936980836 2:118263775-118263797 TGTAACAAAGTGCCACAAACTGG - Intergenic
937783658 2:125869728-125869750 TGTAACGAAGTGCTACAAGCTGG - Intergenic
938084027 2:128386409-128386431 TGTAACAAAGCGCCACAGGCTGG + Intergenic
938160760 2:128982737-128982759 GGTAACAAAGTACCACAGTCTGG - Intergenic
938849598 2:135247278-135247300 GGAGACAGAGTGACACAAGTAGG + Intronic
940153704 2:150630559-150630581 TGTAACAAATTGCCACAAACTGG - Intergenic
941522502 2:166563953-166563975 GGTAACAAATTACCACAAACGGG - Intergenic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942188277 2:173445482-173445504 CATAACAAAGTGCCACAAACTGG + Intergenic
943110214 2:183595364-183595386 TGAAACAAATTGCCACAAACTGG + Intergenic
943265933 2:185732424-185732446 TGTAACAAAGTACCACAAGCTGG - Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
944388253 2:199188592-199188614 TGCAACAAAGTACCACAGGCTGG + Intergenic
945438298 2:209845295-209845317 GGAAGCATAGTGCCATAATCAGG - Intronic
946004910 2:216516296-216516318 GGAAACAAAATGGAACAGGCAGG - Intronic
946460828 2:219867104-219867126 TGTAACAAAGTACCACAAACTGG + Intergenic
946774180 2:223120208-223120230 GGAAACAAAGAGAGAGAAGCAGG - Intronic
947956396 2:234195820-234195842 TGAAGCAAAGTGCCACAAGCTGG + Intergenic
948147906 2:235722219-235722241 GGTAACAAAGTACCACAAACTGG + Intronic
948260967 2:236604158-236604180 TGTAACAAAGTGCCCCAAGCTGG + Intergenic
948287804 2:236800631-236800653 TGTAACAAATGGCCACAAGCTGG + Intergenic
948398045 2:237661976-237661998 CATAACAAAGTGCCACAAACTGG + Intronic
948719326 2:239888535-239888557 TGTAACAAAGTACCACAGGCTGG - Intergenic
1169238264 20:3950567-3950589 TGTAACAAAGTGCCACAAATTGG - Intronic
1169689500 20:8314880-8314902 TGAAATAAAGTGCCAGTAGCTGG - Intronic
1170018901 20:11813834-11813856 TGTAACAAAGCGCCACAAACTGG - Intergenic
1170044655 20:12072451-12072473 TAAAACAAAGTACCACAAACTGG - Intergenic
1171100776 20:22381896-22381918 GGAAATACAGTCCCATAAGCAGG + Intergenic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1171446139 20:25206038-25206060 GGAAAGCACGTGCCACATGCGGG - Intronic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1174746423 20:53067792-53067814 TGGGACAAAGTGCCACAAACTGG + Intronic
1175047234 20:56118643-56118665 GCAAACAGAGTACCACAAACTGG + Intergenic
1175560636 20:59926248-59926270 CTTAACAAAGTGCCACAAACTGG + Intronic
1176263210 20:64194214-64194236 GGAAACAAACAGGCACAAGGTGG + Intronic
1176456819 21:6920098-6920120 TGTAACAAAGTACCACAAACTGG - Intergenic
1176834992 21:13785158-13785180 TGTAACAAAGTACCACAAACTGG - Intergenic
1177107458 21:16977972-16977994 CATAACAAAGTACCACAAGCAGG + Intergenic
1177239083 21:18432779-18432801 CTAAACAAAGTGCCACAAGCTGG - Intronic
1177302813 21:19272000-19272022 GGTAACAAAATACCACAAACTGG + Intergenic
1178032116 21:28539810-28539832 TGTAACAAAATGCCACAAACTGG - Intergenic
1178252174 21:31014136-31014158 TACAACAAAGTGCCCCAAGCAGG + Intergenic
1178433579 21:32537411-32537433 TGTAACAAATTGCCACAAACTGG + Intergenic
1178885883 21:36484398-36484420 TGTAACACAGTGCCACATGCTGG + Intronic
1179014851 21:37587747-37587769 TGGAACAAACTGCCACAGGCCGG + Intergenic
1179047695 21:37861196-37861218 TGTAACAAAGTACCACAAACTGG + Intronic
1179248208 21:39651243-39651265 GGTAACAAAGCGCCTCAAACTGG + Intronic
1179318665 21:40269542-40269564 TGTAACAAAGTTCCACAAACTGG + Intronic
1182192234 22:28473987-28474009 TGTAACAAAGTACCACAAACTGG - Intronic
1182606025 22:31504589-31504611 TGTAACAAAGTACCACAAACCGG + Intronic
1182720696 22:32396508-32396530 GTAAACAAATAGCCACAAGATGG + Intronic
1182731033 22:32493768-32493790 GAAAAAAAAGTTCCACAATCAGG - Intronic
1183857461 22:40645095-40645117 GGAAATAAAGACCCACAAGAGGG + Intergenic
1184486914 22:44785289-44785311 GCCAGCAAAGTGCCACAACCTGG + Intronic
1185184906 22:49393187-49393209 CACAACAAATTGCCACAAGCTGG - Intergenic
949285054 3:2392819-2392841 TGTAACAAAGTACCACAAACTGG + Intronic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
951112858 3:18825152-18825174 TGCATCAAAGTGCCACAAACTGG + Intergenic
952108965 3:30100436-30100458 GGCAACAAAGTACCAAAAACTGG - Intergenic
952218548 3:31301695-31301717 CGTAACAAAATACCACAAGCTGG + Intergenic
953716731 3:45322221-45322243 TATAACAAAGTGCCACCAGCTGG + Intergenic
953732110 3:45458708-45458730 TGAAACAAAATGGCACAATCTGG - Intronic
955064976 3:55526297-55526319 TGTAACAAAGTACCACAAACTGG - Intronic
955497121 3:59545304-59545326 GGTAACAAAGTGCCACAAACTGG - Intergenic
956534373 3:70259692-70259714 TGTAACAAAGTGCCACAAACTGG + Intergenic
956752387 3:72353648-72353670 CGTAACAAAGTACCACAAACTGG - Intergenic
956944018 3:74198156-74198178 TGTAACAAAGTGCCACAAGCTGG - Intergenic
958552343 3:95632436-95632458 TGTAACAAAGTAGCACAAGCTGG - Intergenic
958800005 3:98744282-98744304 TGAAACAAAGTGCCACATACTGG - Intronic
959211486 3:103388744-103388766 TGTAACAAAGTGCTACAAACTGG - Intergenic
959830311 3:110853770-110853792 CGTAACAAAGTACCACAACCTGG - Intergenic
959940533 3:112076428-112076450 GAAATCAAAGTGCTATAAGCAGG - Intronic
960235479 3:115277158-115277180 TGTAACAAAGTACCACAAACTGG + Intergenic
960851559 3:122060039-122060061 GGTAACAAAGTACCACAAACTGG - Intronic
961203383 3:125061877-125061899 TGTAACAAAGTCCCACAAACTGG + Intergenic
962868241 3:139465702-139465724 GAAAACAAACTGCCTCAAACAGG - Intronic
962934646 3:140068571-140068593 GGAATCAAACTGTCACAAGGTGG - Intronic
963669052 3:148229418-148229440 TGTAACAAAGTACCACAAACTGG + Intergenic
963966823 3:151381184-151381206 AGAAACACAGTGCCACAAGAAGG - Intronic
964165093 3:153694748-153694770 GGAAACAAAGCTCCTGAAGCAGG - Intergenic
964795015 3:160487583-160487605 TGAAGCAAAGTACCACAAACTGG + Intergenic
965290947 3:166879583-166879605 GGTAACAAAGTACCACAATCTGG + Intergenic
965898731 3:173612726-173612748 TGTAACAAAGTACCACAAACTGG + Intronic
965900604 3:173636405-173636427 GGAAACCGAGGTCCACAAGCTGG + Intronic
965903184 3:173669288-173669310 TGTAACAAAGTACCACAAACTGG + Intronic
966804678 3:183797782-183797804 GTAAACAAAGAGCAAGAAGCAGG - Intronic
966902157 3:184494329-184494351 GGAAAGAAAGGGCCACAAGCAGG - Intronic
968280116 3:197470805-197470827 CAAAACAAAGTGCCACAAATTGG + Intergenic
969033493 4:4231704-4231726 TGTAACAAAGTGCCACTAACTGG + Intergenic
970911081 4:21276312-21276334 TGAAACAAACTACCACAAACAGG - Intronic
971225847 4:24750914-24750936 CCTAACAAAGTGCCACAAACTGG - Intergenic
972811038 4:42586077-42586099 CGAAACAATGTGCCAGAAGCTGG + Intronic
972811999 4:42599760-42599782 GGAAATAAAGTGCCCTAAGAAGG + Intronic
972862059 4:43181370-43181392 CATAACAAAATGCCACAAGCTGG + Intergenic
973631333 4:52823757-52823779 TGTAACAAAATGCCACAAACTGG + Intergenic
974419811 4:61658886-61658908 TGTAACAAAGTACCACAAACAGG + Intronic
974546535 4:63315735-63315757 GGTAACAAAGCACCACAAACTGG + Intergenic
974682662 4:65183258-65183280 GGTAACAAAGTGCCTCCAACTGG - Intergenic
975086153 4:70342245-70342267 TGTAACAAAGTGCCGCAAACTGG + Intergenic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
976020558 4:80619265-80619287 TGAACCAAAATGCCACAAGGTGG + Intronic
976611822 4:87038504-87038526 GGAAACAAAAGGCCAAAAGATGG + Intronic
976956580 4:90908916-90908938 CGTAACAAAGTACCACAAACTGG + Intronic
977048914 4:92102358-92102380 TGAGACAAAGTGCCACAAACTGG + Intergenic
977366654 4:96077777-96077799 CATAACAAAGTACCACAAGCTGG + Intergenic
977895379 4:102358628-102358650 TGTAACAAAGTGCCACAAACTGG - Intronic
978227918 4:106360916-106360938 TGTAACAAAGTACCACAACCTGG - Intergenic
978738194 4:112107869-112107891 TGAAACAAAGTACCACAAAGTGG - Intergenic
979135415 4:117105542-117105564 TGTAACAAATTGCCACAAACTGG - Intergenic
979350053 4:119632881-119632903 CGTAACAAAGTACCACACGCTGG - Intergenic
979804927 4:124959805-124959827 GTAAAGAAAGTGCCACCAGAGGG + Intergenic
979932437 4:126647784-126647806 AGTAACAAAGTGCCACAAACTGG - Intergenic
980593195 4:134918199-134918221 AGTAACAAAGTACCACAAACTGG - Intergenic
981281836 4:142967311-142967333 TGAAACAAAGCACCACAAACTGG - Intergenic
982124419 4:152172124-152172146 CATAATAAAGTGCCACAAGCTGG - Intergenic
982363831 4:154553165-154553187 TGTAACAAAGTACCACAAACTGG + Intergenic
982434444 4:155367510-155367532 TGTAACAAATTGCCACAAACTGG - Intronic
982559315 4:156910149-156910171 GGTAACAAACTGCCCCAAGCAGG - Intronic
983078456 4:163355040-163355062 CAAAACAAAGCACCACAAGCTGG + Intergenic
983089111 4:163483517-163483539 TACAACAAAGTGTCACAAGCTGG + Intergenic
984196079 4:176659800-176659822 TACAACAAAGTACCACAAGCTGG + Intergenic
985846269 5:2351757-2351779 TCAAACAAAGTGCCACAAGGTGG - Intergenic
985922942 5:2993780-2993802 GTAAAAAAATTGCCACAAACTGG + Intergenic
986057609 5:4154176-4154198 GGTAACAAAATGCCATAAACTGG - Intergenic
986215999 5:5719805-5719827 GATAACAAAGTGCCACAGGCCGG + Intergenic
986363164 5:7001871-7001893 CATGACAAAGTGCCACAAGCTGG + Intergenic
986576450 5:9218260-9218282 TAAAACAAAGTACCACAAACAGG - Intronic
986668730 5:10125401-10125423 GTCAACAAAGTACCACAAACTGG - Intergenic
986710782 5:10486668-10486690 GGGAACAAACTGCCACACACAGG - Intergenic
986712526 5:10498401-10498423 TGTAACCAAGTGCCACAAACTGG + Intergenic
986805831 5:11308126-11308148 TGTAACAAAATGCCACAAACTGG - Intronic
986990693 5:13549531-13549553 TGTAACAAAGTACCACAAACTGG + Intergenic
989277210 5:39603086-39603108 TGAAACAAATTACCACAAACTGG + Intergenic
989297027 5:39840831-39840853 TGACACAAAGTACCACAAACTGG - Intergenic
990002329 5:50908718-50908740 TATAACAAAGTACCACAAGCTGG - Intergenic
990057707 5:51604804-51604826 TAAAACAAAGTGCCACAAAGAGG - Intergenic
990165312 5:52988200-52988222 GGAAGCAAAGTGGCTCAAGGTGG - Intergenic
991292907 5:65050133-65050155 CAAAATAAAGTGCCACAAACTGG + Intergenic
991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG + Intronic
993484642 5:88467960-88467982 TGTAACAAAGTGCCACAAACTGG + Intergenic
993576081 5:89602428-89602450 CTAAACAAAGTACCACAAACTGG + Intergenic
994671376 5:102765598-102765620 TGTAACAAAGTACCACAAACCGG + Intronic
994697087 5:103085976-103085998 TGTAACAAAGTCCCACAAACTGG + Intergenic
995356028 5:111238573-111238595 GGTAACAAAGTGCCACAGACTGG - Intronic
996399030 5:123039843-123039865 TGTAACAAAGTGCCACAAACTGG - Intergenic
996506572 5:124274987-124275009 GCTAACAAAGTACCACAAACAGG + Intergenic
996738341 5:126777154-126777176 GGAAACAAAGTGCTGCGAGCAGG + Exonic
996777170 5:127145172-127145194 GGTAACAAAGTACTACAAACTGG - Intergenic
997518782 5:134508895-134508917 TGTAACAAAGTGCCACAGGCAGG - Intergenic
997903433 5:137790211-137790233 TGTAACAAAGTACCACAGGCTGG + Intergenic
998534768 5:142919448-142919470 CGTAACAAAGTGCCACAAACTGG - Intronic
998655747 5:144177382-144177404 TGTAACAAAGTACCACAAACTGG + Intronic
999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG + Intronic
999632268 5:153583277-153583299 TGTAACAAAATTCCACAAGCAGG + Intronic
1000352258 5:160361202-160361224 GGAGCTAAAGTGCCACAGGCTGG + Intronic
1000473086 5:161670773-161670795 GGAAAAAAAGTGAAACAAACAGG + Intronic
1000766627 5:165299596-165299618 AGAAAGAAAGTGCCTGAAGCTGG - Intergenic
1000810839 5:165858792-165858814 GTAAACAAAGTGCTACAAACAGG + Intergenic
1000865131 5:166504350-166504372 CGTAACAAAGTACCACAAACTGG + Intergenic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1001720367 5:173852068-173852090 ATAAACAAAGTACCACAAACTGG - Intergenic
1001852592 5:174982544-174982566 CATAACAAAGTGCCACAACCTGG + Intergenic
1003644334 6:7902254-7902276 TGTAACAAAGTTCCACAAACCGG - Intronic
1004083288 6:12417472-12417494 TGTAACAAAGTGCCACAAACTGG - Intergenic
1004233789 6:13855341-13855363 TGTAACAAAGTACCACAAACTGG + Intergenic
1004457382 6:15803626-15803648 GGAAACTAAGTGCTGCAAGGTGG + Intergenic
1004975982 6:20966955-20966977 TGTAACAAAGTACCACAAACTGG + Intronic
1005103993 6:22203479-22203501 CGTAACAAAGTACCACAGGCTGG - Intergenic
1005213387 6:23496049-23496071 AGTAACAAATTGCCACAAACTGG - Intergenic
1005315199 6:24597308-24597330 GGAAGCAAACTGTCACAAGGAGG + Intronic
1005353317 6:24958734-24958756 TGTAACAAAGTACCACAAACTGG + Intronic
1005889090 6:30121699-30121721 CGTAACAAAGTACCACAGGCTGG - Intergenic
1007000359 6:38306266-38306288 GTAAACAAAGTGACACAAATTGG - Intronic
1007296554 6:40826589-40826611 AGAAACAAAGTACCATAAACTGG - Intergenic
1007958618 6:45939007-45939029 TACAACAAAGTACCACAAGCTGG + Intronic
1008526581 6:52413307-52413329 CGTAACAAAGTACCACAAGCTGG - Intergenic
1008666690 6:53723668-53723690 GGAAACAAAGTCCAATAAGCAGG + Intergenic
1008670731 6:53766055-53766077 GGAAACAGAGTGCCTCAAATAGG - Intergenic
1010002556 6:70962357-70962379 TGTAACAAAGTTCCACAAACTGG - Intergenic
1010650093 6:78444431-78444453 TGTAACAAAATGCCACAGGCTGG + Intergenic
1011591629 6:88975602-88975624 TGTAACAAAAGGCCACAAGCTGG + Intergenic
1011788024 6:90868041-90868063 TGTAACAAAGTACCACAAACTGG - Intergenic
1012073054 6:94647634-94647656 GAAAACAAAGTACCACAAATTGG + Intergenic
1012244447 6:96911088-96911110 CGTAACAAAGTACCACAAACTGG + Intergenic
1013374643 6:109502598-109502620 TGAAACAAACTGCCGCAAACTGG - Intronic
1013387064 6:109642238-109642260 CATAACAAAGTGCCACAAACTGG - Intronic
1013580252 6:111527007-111527029 CGTAACAAAGTACCACAAACTGG + Intergenic
1014078048 6:117259561-117259583 GGACACAAAATTCCACAAACAGG - Intergenic
1015428781 6:133105178-133105200 GGAAATAAAGTGCAAAAAGGAGG + Intergenic
1017780071 6:157709021-157709043 CATAACAAAATGCCACAAGCTGG + Intronic
1017898538 6:158701719-158701741 AGTAACAGAGTGCCACAACCTGG + Intronic
1018519412 6:164630069-164630091 GAAAACACTGTGCCACAAGAGGG - Intergenic
1018682670 6:166276908-166276930 AGAAAAAATGTGCCACAAACTGG + Intergenic
1018768440 6:166952279-166952301 GTAACAAAAGTGCCACAAGCTGG - Intronic
1018829196 6:167429557-167429579 TGTAACAAAATGCCACAAACTGG + Intergenic
1021055443 7:16041643-16041665 GGAAAGAAAGTCCCAGAAGGAGG + Intergenic
1021971594 7:25970518-25970540 TGTAACAAAGTGCCAGAGGCTGG + Intergenic
1021972629 7:25980746-25980768 CAAAACAAAGTGCCACAGACTGG - Intergenic
1023415488 7:39928231-39928253 TATAACAAAGTACCACAAGCTGG + Intergenic
1023475334 7:40572064-40572086 GGAAACAAGATGCCACATTCGGG - Intronic
1023639145 7:42240369-42240391 GGTAACAAAGTACCAAAAACTGG + Intergenic
1023684047 7:42717085-42717107 GGTAAGAAAGTGCCACTAGGAGG - Intergenic
1023740243 7:43274283-43274305 AGATACAAAGTACCAGAAGCGGG - Intronic
1023862147 7:44223280-44223302 GGAAAGAAAGGGAGACAAGCTGG - Intronic
1024010964 7:45266430-45266452 TGTAACCAAGTGCCACAAACTGG + Intergenic
1024109841 7:46133978-46134000 GGAAACAAGCTCCCACCAGCAGG + Intergenic
1025850594 7:65240104-65240126 GGAAACAAACTTCCCCGAGCAGG + Intergenic
1026105202 7:67415311-67415333 AGCAACAAAGTGCCACAGACTGG + Intergenic
1028109493 7:86921610-86921632 TGCAACAGAGTGCCACAAACTGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028323938 7:89498288-89498310 TGAAACAATGTGCCACAAACTGG - Intergenic
1029159712 7:98542995-98543017 TGTAACAAAGTACCACAAACTGG + Intergenic
1029295548 7:99537490-99537512 TGTAACAAAGTACCACAAACTGG - Intergenic
1029662438 7:101971789-101971811 GGCAACCAAGTGCCACTGGCAGG + Intronic
1029969372 7:104773936-104773958 TGTAACAAAGTACCACAACCCGG - Intronic
1030076574 7:105742036-105742058 CATAACAAAGTGCCACAATCTGG - Intronic
1030101042 7:105945591-105945613 GTGAACAAAGTGCCACAAACTGG - Intronic
1030201478 7:106909842-106909864 CATAACAAAGTGCCACAAACTGG - Intergenic
1030688724 7:112511454-112511476 TGTAACAAAGTACCACAAACTGG + Intergenic
1030755877 7:113287271-113287293 AGTAACAAAGTACCACAAACTGG + Intergenic
1030778062 7:113561465-113561487 TGTAACAAAGTACCACAAACAGG + Intergenic
1032637428 7:133725259-133725281 GGAAGCAAAGAGGCAAAAGCAGG + Intronic
1033309048 7:140246499-140246521 GGTAATAAATTGCCACAAGCAGG + Intergenic
1033596160 7:142860322-142860344 GGAAAGAAAATGCCAGCAGCAGG - Intronic
1034032477 7:147783499-147783521 TGCCACAAAGTGCCACAAACTGG + Intronic
1034217698 7:149421020-149421042 TGTAACAAAGTGCCACAAACTGG - Intergenic
1034574409 7:151984954-151984976 TGTAACAAAATGCCACAAACTGG + Intronic
1034912733 7:155010683-155010705 TGTAACAAAGTGCCACATACTGG - Intergenic
1035286360 7:157809813-157809835 GGGGTCAAAGTGCCACAAACTGG - Intronic
1036990355 8:13585535-13585557 TGTAACAAAGTGCCACCAACTGG + Intergenic
1037611316 8:20478547-20478569 TGAAATAATGTGCCACATGCTGG - Intergenic
1037755701 8:21708898-21708920 TGTAGCAAAGTACCACAAGCTGG - Intronic
1038642494 8:29339336-29339358 AGAAACACAGTGGCTCAAGCAGG + Intronic
1038951018 8:32414637-32414659 AGAAATAAAGTACCACAAACAGG - Intronic
1039778759 8:40762863-40762885 TGTAACAAATTGCCACAAACTGG - Intronic
1042356553 8:67834846-67834868 TGTAACAAAGTACCACAAACTGG + Intergenic
1042749030 8:72138117-72138139 ATAAACAAAGTGCCACAACCTGG + Intergenic
1043735641 8:83739715-83739737 TGTAACAAAGTACCACAAACTGG + Intergenic
1045250078 8:100475643-100475665 GGAAAAACAGGGCCACAGGCTGG + Intergenic
1045876764 8:106990823-106990845 GGTAACAAAATGTCACAAACTGG - Intergenic
1046303065 8:112323648-112323670 TGAAACAAAGTACCACAAACTGG - Intronic
1046822896 8:118653511-118653533 CATAACAAAGTTCCACAAGCTGG + Intergenic
1047808557 8:128383095-128383117 GGACACAAAGTGGCACAAAGAGG + Intergenic
1047862993 8:128989505-128989527 TGTAACAAAGTGCCACAACTGGG + Intergenic
1048230387 8:132634741-132634763 TATAACAAAGTGCCACAAACTGG - Intronic
1048457573 8:134591929-134591951 GCAATCAAAGTGCCACATGCTGG - Intronic
1048586938 8:135783149-135783171 GGGAACAAAATACCACAAACCGG + Intergenic
1048599335 8:135902381-135902403 TGTAACAAAGTACCACAACCGGG + Intergenic
1049291780 8:141807103-141807125 TGAAACAGAGTGCCCCACGCTGG + Intergenic
1050164105 9:2746440-2746462 TGTAACAAAGTAGCACAAGCTGG - Intronic
1051650768 9:19322229-19322251 GGAAAAAAAGTTCCACAACTAGG - Intronic
1051686631 9:19664954-19664976 CGAAACAAACTACCACAAACGGG - Intronic
1051745642 9:20292540-20292562 TGTAACAAAGTACCACAAACTGG + Intergenic
1052296002 9:26896419-26896441 CATAACAAAGTGCCACAAACTGG - Intergenic
1053006130 9:34605868-34605890 CGTAACAAAGTGCCACAAACTGG - Intergenic
1054772284 9:69094070-69094092 TGTAACAAAGTTCCACAAACGGG + Intronic
1056602256 9:88055314-88055336 CGTAACAAAGTGCCACACGCTGG + Intergenic
1056922803 9:90807048-90807070 TGAAATAAAGTGCAGCAAGCAGG + Intronic
1057558552 9:96109072-96109094 CATAACAAAGTGTCACAAGCTGG - Intronic
1057962232 9:99467870-99467892 GGAAAAAAAATCCAACAAGCTGG + Intergenic
1058087854 9:100769673-100769695 CATAACAAAGTGCCACAGGCTGG + Intergenic
1058672268 9:107369511-107369533 AGAAACAAAGTGCCAGAAGCCGG - Intergenic
1058820202 9:108722662-108722684 TGTAACAAATTGCCACAAACTGG - Intergenic
1058841264 9:108911874-108911896 GGAAACAAAGCAACACAAGTGGG + Intronic
1059409701 9:114124292-114124314 GGTAAGAGAGTGACACAAGCAGG - Intergenic
1059498814 9:114732843-114732865 CGTAACAAAGTGCCACAGACTGG - Intergenic
1059850842 9:118337369-118337391 TGCAACAAAGTACCACAACCTGG - Intergenic
1060115924 9:120940682-120940704 GGTAACAAAGTGCCACAAACTGG + Intergenic
1060303242 9:122388579-122388601 TGCAACAAAGTACCACAAACTGG + Intronic
1061551750 9:131338913-131338935 GGTAACAAAATGTCACAAACTGG - Intergenic
1061955797 9:133960713-133960735 GCAGACAAAGCGCCACATGCCGG - Intronic
1062099393 9:134720313-134720335 GGAAACAAAGGGCCAGGGGCTGG - Intronic
1062569111 9:137176408-137176430 TGTAACAAAGTGTCACAAACTGG - Intronic
1062737430 9:138145027-138145049 CGTAACAAAGTGCCACAAAATGG + Intergenic
1186113288 X:6278091-6278113 TGTAACAAAGTACCACAACCCGG + Intergenic
1186849520 X:13567002-13567024 GGATACAAATTGCCACATGGAGG - Intergenic
1187272220 X:17789453-17789475 GGAGAAAAAGTGACACAGGCTGG - Intergenic
1187338781 X:18403155-18403177 TGCAACAAAGTGCCACAATCTGG - Intergenic
1188392100 X:29633565-29633587 TGTAACAAATTACCACAAGCTGG + Intronic
1188604157 X:32007473-32007495 TGTAACAAATTACCACAAGCTGG - Intronic
1189136719 X:38558279-38558301 TGTAACAAAGTACCACAAGCTGG + Intronic
1189193259 X:39129854-39129876 TGCAACAAAGTACCACAAACTGG + Intergenic
1189211794 X:39290084-39290106 CATAACAAAGTGCCACAGGCTGG + Intergenic
1189213626 X:39304992-39305014 TGTAACAAAGTGCCACAAGCTGG + Intergenic
1189343178 X:40220022-40220044 TGTAACAAAGTACCACAAACTGG + Intergenic
1189913057 X:45830297-45830319 GGAAACAAATTGCAACAAACTGG + Intergenic
1189915925 X:45855890-45855912 GGCTACAAAGTCCCACAAACTGG - Intergenic
1192560197 X:72123324-72123346 GGGAAGAAAATGCCAAAAGCAGG + Intergenic
1193758136 X:85433936-85433958 TGTAACAAAGTGCCACAAAATGG - Intergenic
1195432397 X:104804036-104804058 AGATACAAAGTACCAGAAGCGGG - Intronic
1195493621 X:105503639-105503661 TGTAACAAAGTGCCACAAATGGG + Intronic
1195552874 X:106187963-106187985 GAAAACAAAATGCTACAATCTGG - Intronic
1196207234 X:112954821-112954843 GGAAACAAAGCAACATAAGCAGG - Intergenic
1197863757 X:130996970-130996992 TGTAACAAAGTACCACAAACCGG - Intergenic
1198573957 X:137989629-137989651 TGTAACAAAGTACCACAAACTGG + Intergenic
1198620264 X:138500090-138500112 TGAAACAAAGTACCACAAACTGG - Intergenic
1198847989 X:140933592-140933614 GCAAACAAAGTTCCACAGGAAGG - Intergenic
1199136301 X:144256956-144256978 GGAGTCAAACTGCCACAAGTTGG + Intergenic
1200399586 X:156011242-156011264 CGTAACAAAGTGCCACAAAATGG + Intergenic
1200756139 Y:6991735-6991757 CAAAACAAAGTACCACAAGTGGG - Intronic
1200931287 Y:8699355-8699377 GGAGACAATGAGCCACAATCTGG + Intergenic
1200955089 Y:8936891-8936913 GGAAGGAAAGTGACACAAACTGG - Intergenic
1201685901 Y:16702203-16702225 GTAACAAAAGTACCACAAGCAGG + Intergenic