ID: 1099749038

View in Genome Browser
Species Human (GRCh38)
Location 12:86747134-86747156
Sequence TGCAGGATAAGGAGCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099749038_1099749042 -9 Left 1099749038 12:86747134-86747156 CCTCCAGTGCTCCTTATCCTGCA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1099749042 12:86747148-86747170 TATCCTGCAGGATTTCAGTGAGG 0: 1
1: 0
2: 3
3: 20
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099749038 Original CRISPR TGCAGGATAAGGAGCACTGG AGG (reversed) Intronic
900788729 1:4666003-4666025 TGCCGTTTACGGAGCACTGGTGG + Intronic
901780268 1:11589713-11589735 TCCAAGCTAAGGAGGACTGGTGG + Intergenic
903236105 1:21951731-21951753 AGCAGGACATGGAGCCCTGGGGG - Intergenic
903570058 1:24297705-24297727 TGCAGGACCAGGTGCACAGGCGG - Intergenic
904287655 1:29462422-29462444 TTCAGGAGAGAGAGCACTGGGGG + Intergenic
910820339 1:91338496-91338518 TGCTGGCTAAGGAGCTATGGTGG - Intronic
913002402 1:114594126-114594148 AAGAGGATAAGGAGCACTAGAGG + Intronic
913208651 1:116565046-116565068 TGCAGGAAAGGAATCACTGGGGG - Intronic
914350477 1:146835661-146835683 TGCAGGGTGAGGGGCTCTGGAGG - Intergenic
914782416 1:150797737-150797759 GGCAGGATCAGGAACACTGGGGG - Intronic
918547010 1:185696513-185696535 TGCAGCAGAAGGAGGACGGGTGG - Intergenic
920174248 1:204090165-204090187 GGAAGGATAAGAAGCTCTGGTGG + Intronic
921827953 1:219695086-219695108 TGCAGGAGACTGATCACTGGTGG - Intronic
922894667 1:229090735-229090757 AGCAGGATAAGGAGTGCAGGGGG - Intergenic
1062775516 10:142930-142952 TTCAGGGGCAGGAGCACTGGAGG + Intronic
1064296653 10:14084816-14084838 TTCAGGAGAAGGAGCAGTCGAGG - Intronic
1065407020 10:25379820-25379842 TTCATGATATGAAGCACTGGGGG - Intronic
1066453243 10:35550197-35550219 TGCAGGGTCACGAGCACTGTAGG - Intronic
1066560896 10:36668726-36668748 TGCAGAATCAGGTGCCCTGGAGG + Intergenic
1067000102 10:42602943-42602965 TGGGGGTTGAGGAGCACTGGTGG - Intronic
1069944176 10:71974583-71974605 TGGAGGGTAGGGAGGACTGGAGG + Intronic
1070862533 10:79684291-79684313 TGCAGGAGGAGGAGGCCTGGCGG + Intergenic
1071530456 10:86387417-86387439 TGCAGGAGAGGGAGGCCTGGCGG - Intergenic
1073050651 10:100664951-100664973 AGCAGGGTAAGGAGGACAGGCGG - Intergenic
1074877529 10:117625782-117625804 AGCAGGAAGAGGAGCAGTGGAGG + Intergenic
1075465414 10:122647199-122647221 TGCTTGAGAAGGAGCAGTGGAGG + Intergenic
1076723669 10:132403801-132403823 TGCAGGGGAAGGGGCACAGGGGG - Intronic
1078776536 11:14398968-14398990 TGCAGGAAAAAAAGCACTTGGGG - Intergenic
1079737512 11:24014459-24014481 AGGAAGGTAAGGAGCACTGGGGG + Intergenic
1080563597 11:33487358-33487380 TGCTGGATGATGAGCCCTGGAGG + Intergenic
1081232615 11:40604854-40604876 AGCAGCATAAGGAGGAATGGAGG + Intronic
1082982464 11:59136227-59136249 TGCAAATTAAGGAGCACTGCGGG + Intergenic
1083743952 11:64724948-64724970 TGCAGGAAGAGGAACAGTGGGGG - Intergenic
1083859790 11:65413929-65413951 TGCAGGATGAGCGCCACTGGGGG + Intergenic
1084157350 11:67321298-67321320 TCCAGGAGAAGGAGCATTTGTGG - Intronic
1084472497 11:69371258-69371280 TCCAGGAAAAGAAGCAGTGGTGG + Intergenic
1091112348 11:132981466-132981488 TGAGGGATAACGGGCACTGGCGG + Intronic
1091448834 12:560245-560267 GGCAAGGTCAGGAGCACTGGGGG + Intronic
1091592836 12:1855496-1855518 TGCAAGACAAGGAGCACCTGGGG + Intronic
1093223242 12:16448779-16448801 TGCAGGATAAGGATAGCTTGGGG - Intronic
1093701048 12:22221019-22221041 TGCAGGCTATGGAGAACTGGAGG + Intronic
1096518683 12:52172147-52172169 TGCAGGGGAAGGAGGGCTGGAGG - Intronic
1098141952 12:67458610-67458632 TGCAGAATAAAGAGAACTTGTGG - Intergenic
1099028449 12:77495029-77495051 TGCTGTATGATGAGCACTGGTGG + Intergenic
1099292627 12:80790145-80790167 TGCTGGATCAGGAGCACAGCGGG - Intergenic
1099749038 12:86747134-86747156 TGCAGGATAAGGAGCACTGGAGG - Intronic
1103402856 12:120654971-120654993 GGGAGGAAAAGGAGAACTGGTGG + Intronic
1105484148 13:20810364-20810386 TTCTTGTTAAGGAGCACTGGTGG - Intronic
1105518741 13:21113103-21113125 AGCAGGAGAAGGGGCAATGGGGG - Intergenic
1106767766 13:32932251-32932273 TGAAAGATAAAGAGAACTGGGGG + Intergenic
1107945149 13:45411463-45411485 TCCAGGAAAAACAGCACTGGAGG - Exonic
1109167473 13:59053688-59053710 TGCAGATTGAGGAGCACTGCTGG - Intergenic
1113570710 13:111354809-111354831 TGCAGGGTGAGGAGTACTGGGGG + Intergenic
1114281042 14:21192578-21192600 TTCAGGCCAAGGAGGACTGGGGG + Intergenic
1116815545 14:49580455-49580477 TTCAGGGTTAGGAGCACAGGTGG + Intronic
1117083498 14:52176153-52176175 TGCAAGGCAAGGAACACTGGGGG - Intergenic
1117934748 14:60890525-60890547 TGCAAGCTAAGGAGCAAGGGAGG + Intronic
1121792458 14:96709405-96709427 GGCAGGATTAGCAGCACTGGTGG + Intergenic
1122415602 14:101548195-101548217 CCCAGGACAAGGAGCAGTGGGGG + Intergenic
1123806310 15:23877559-23877581 TCCAGGAGGAGGAGCATTGGAGG + Intergenic
1123808210 15:23897114-23897136 TCCAGGAGAAGGAGCATTGCAGG + Intergenic
1123878688 15:24652873-24652895 TCCAGGAAAAGGAACAATGGAGG + Intergenic
1123899527 15:24862757-24862779 TTCAGGAGGAGGAGCATTGGAGG + Intronic
1127822035 15:62666911-62666933 TGCTGGATAAGAGGCTCTGGGGG - Intronic
1128708321 15:69853356-69853378 AGGATGATAAAGAGCACTGGAGG + Intergenic
1129767159 15:78177620-78177642 TGCAGGCTGATGAGCCCTGGAGG - Intronic
1130297981 15:82660542-82660564 TGCAGAATGAGGAGTTCTGGGGG - Intronic
1130871767 15:87977650-87977672 AGCAGGATGAGGAGAGCTGGAGG + Intronic
1131977667 15:97961563-97961585 TGCAGGATAGGGAGGAGTGGAGG - Intronic
1132426968 15:101725586-101725608 TGCAGGAGAAGGAGCGGAGGGGG + Intergenic
1133033595 16:3022893-3022915 TGCAGGGTAGGGGGGACTGGGGG + Exonic
1134027569 16:10966008-10966030 GGCAGGATAAGGAGCTGTTGGGG - Intronic
1134419106 16:14070135-14070157 TGTAAGATCAGGAGCCCTGGAGG - Intergenic
1138075776 16:54041259-54041281 GGCAGGAGAGGGAGCACAGGGGG + Intronic
1139653990 16:68376531-68376553 TTCAAAATAAGGAGCCCTGGGGG - Intronic
1139983561 16:70879878-70879900 TGCAGGGTGAGGGGCTCTGGAGG + Intronic
1142056833 16:88002980-88003002 TGGAGGCTATGGAACACTGGTGG - Intronic
1143164164 17:4889678-4889700 TGCAGGAGAAGGAGCAGCAGCGG + Exonic
1143305362 17:5942136-5942158 TGCAGGAGGAGGAGCAGGGGAGG + Intronic
1143753117 17:9045492-9045514 AGAAGGATAAGGAGAAATGGAGG - Intronic
1144101041 17:11942546-11942568 TGGGGAAGAAGGAGCACTGGGGG + Intronic
1148783957 17:50136162-50136184 AGCAGGAGAAGGGGCGCTGGCGG - Exonic
1151242878 17:72771949-72771971 TGCAGGAAAAGGAGGGTTGGTGG - Intronic
1152795517 17:82304338-82304360 GGAAGGAGAAGGAGCCCTGGGGG + Intergenic
1154065906 18:11106783-11106805 TTCAGGGAAAGGAGCACTGCTGG - Intronic
1155811083 18:30235853-30235875 TGCAGAATAACTAGCACTGTGGG + Intergenic
1160111580 18:76037280-76037302 TGCAGGATGAGGAGAGGTGGTGG + Intergenic
1160424848 18:78772799-78772821 TGCAGCAAAAGGAGCTCTGCAGG + Intergenic
1161953839 19:7482213-7482235 TGCAGGACCAGGAGCAGAGGGGG + Intronic
1162540218 19:11291132-11291154 TGAAGGGTTAGGAGGACTGGAGG - Intergenic
1162990891 19:14301429-14301451 TGCATCAGGAGGAGCACTGGAGG + Intergenic
1165062640 19:33212344-33212366 TGAAGGCGAAGGAGCCCTGGAGG + Exonic
925910569 2:8571057-8571079 TGCAGGGGAAGGAGCCCTGGCGG + Intergenic
926142157 2:10374105-10374127 TGCAGCATCTGGAGCACTGCAGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
930225346 2:48786703-48786725 GGCAGGAAAAGGAACACTGACGG - Intergenic
933725066 2:85422025-85422047 TGCAGGATAAAGAGCCAAGGTGG + Intronic
934988086 2:98901546-98901568 TCCAGGATAAGGTGCCCTGTGGG - Intronic
936876909 2:117201079-117201101 TGCAGGATAAGGAGCAAAAAGGG - Intergenic
938631537 2:133173047-133173069 TTCAGGTTCAGGAGCACTGAGGG + Intronic
939455779 2:142432996-142433018 TGCAGGAAAAAGAGTGCTGGTGG + Intergenic
939575634 2:143891893-143891915 TGGAGGCTAAAGAGCACTAGAGG + Intergenic
940416819 2:153432622-153432644 TGGATGACAAGCAGCACTGGGGG - Intergenic
942090903 2:172489930-172489952 TACATAATAAGGAGAACTGGGGG + Intronic
947030427 2:225786401-225786423 TGCAGGGAAAAAAGCACTGGAGG + Intergenic
947159150 2:227194304-227194326 TCCAGGAAAGGGAGCAGTGGTGG - Intronic
947201246 2:227616593-227616615 TGATGGATACGGAGCAGTGGAGG + Intronic
1168839601 20:901054-901076 AGCAGGATTAGGAGCAATGTCGG - Intronic
1169186333 20:3620196-3620218 TCCAGGGAAAGGAGCACAGGAGG + Intronic
1172519655 20:35558547-35558569 AGCAGGAGCAGGAGCAGTGGTGG + Intergenic
1174202868 20:48819386-48819408 AGGAGGAGAAGGAGCCCTGGTGG - Intronic
1174902918 20:54520006-54520028 TGCAGGTCAAGGAGCAGTGGTGG - Intronic
1185149699 22:49157085-49157107 TGTAGGACAAGAAGCACTTGAGG - Intergenic
949575242 3:5332459-5332481 TGCAAGATGAAGAGCTCTGGAGG + Intergenic
950579168 3:13851445-13851467 TGAAGGATAAGGAGTCCAGGTGG - Intronic
951293314 3:20900766-20900788 GGAAGGAGAAGGAGAACTGGTGG + Intergenic
952497451 3:33928490-33928512 TGCAGGAGAAAGAGGACTGGGGG + Intergenic
953149874 3:40315160-40315182 TGCTGGGTAAGGAACATTGGAGG - Intergenic
954786164 3:53094054-53094076 TGCAGAATCAGGAACTCTGGTGG - Intronic
955225979 3:57060711-57060733 TGCAGGATCAGGAAGAGTGGGGG - Exonic
955818493 3:62873543-62873565 TGCAAGATGAGGGGCAGTGGCGG - Intronic
956229856 3:67001794-67001816 TGCAGTATGAGAAACACTGGAGG - Intronic
957198646 3:77103087-77103109 TGGAGCAGAAGGAGCACAGGGGG + Intronic
957478291 3:80756022-80756044 TGAAGCATAATGAGAACTGGAGG + Intergenic
957959619 3:87232432-87232454 TCCAGAATAAGGAGCACTAAAGG - Intronic
958002438 3:87767525-87767547 TGCGGAATAATGGGCACTGGAGG - Intergenic
959077371 3:101763441-101763463 TGCAGCAGAAGGATCACTTGAGG - Intronic
960006977 3:112790704-112790726 TGCTGGATCAGGAGCGCAGGGGG + Intronic
961493059 3:127268768-127268790 TGCAGGAACAGCAGCACTGTGGG + Intergenic
962933510 3:140058958-140058980 TGGAGGATAAGAAGCTATGGAGG + Intronic
963789229 3:149566275-149566297 TGGAAGAAAAGGAACACTGGTGG - Intronic
967310783 3:188104147-188104169 TGCCGGATGGGGAGCCCTGGAGG - Intergenic
967519557 3:190414393-190414415 AGCTGGAGAAGCAGCACTGGAGG - Intergenic
969097419 4:4744113-4744135 GGAAGAATGAGGAGCACTGGTGG + Intergenic
969302182 4:6303682-6303704 TGCAGGTTAGGGAACACAGGAGG - Intergenic
975041312 4:69747264-69747286 TGCAGGTTACTGAGCACTGGTGG + Intronic
975819524 4:78255269-78255291 TTCAGGATGGGGAGGACTGGCGG + Exonic
985846566 5:2354044-2354066 TGCAGGGGAAGGTGCACTGCGGG - Intergenic
986040056 5:3985044-3985066 TGAAGGACAAGGGGCACAGGAGG + Intergenic
986505972 5:8451681-8451703 TCCAGGAAAAGGAACACTTGGGG - Intergenic
988018424 5:25591910-25591932 TGAAGGAAAAAGAGCACTGATGG + Intergenic
989383773 5:40835073-40835095 TTCCGGATAAGGGGAACTGGTGG - Intronic
990220548 5:53583749-53583771 GGCAAGATAAGACGCACTGGTGG + Intronic
992176279 5:74151914-74151936 TGTGGTATAAGGAGCAGTGGTGG - Intergenic
993387127 5:87273490-87273512 TGCAGGGTGAGGGGCAGTGGTGG + Intronic
994719570 5:103365391-103365413 TGCTGGATAAGAAACTCTGGGGG + Intergenic
995904132 5:117103051-117103073 GGGAGGAAAAGGAGCCCTGGAGG + Intergenic
999055730 5:148574067-148574089 TGCGGGAAAAGGAGCAATGATGG - Intronic
999119416 5:149197826-149197848 TGCACACTAAGAAGCACTGGTGG - Intronic
999621593 5:153480118-153480140 TGCAGGATGAGGGGAAGTGGGGG - Intergenic
999717412 5:154372598-154372620 TGCAGGACAGGCAGCACTGCGGG + Intronic
1001715717 5:173814218-173814240 TGCAGGTGAAGGAGCTGTGGGGG - Intergenic
1002713710 5:181211386-181211408 TGCAGGATAATACCCACTGGAGG + Intergenic
1005499099 6:26414342-26414364 TCCAGGATAAGGATCACTGTAGG + Exonic
1006566037 6:34958287-34958309 TGCAGGTTGGGGTGCACTGGCGG - Intronic
1007119918 6:39371264-39371286 TGCAGGAGAAGGAAACCTGGAGG + Intronic
1007766611 6:44164325-44164347 TGCAGGATAGGGAGTAGGGGAGG + Intronic
1009879451 6:69547498-69547520 TCCAGTATTAGGAGCACTGAGGG - Intergenic
1009962513 6:70540820-70540842 TGCAGAATCAGCAGCACTGTAGG + Intronic
1011090546 6:83593596-83593618 AGCAGGAGAAGGAGCAGTTGCGG + Exonic
1011325029 6:86141141-86141163 TGATGAATAAGGAGGACTGGTGG + Intergenic
1012964668 6:105660623-105660645 GGCAGGAGAAAGAACACTGGGGG + Intergenic
1013824310 6:114193192-114193214 TGCTTCATAAGCAGCACTGGTGG + Intronic
1018051690 6:160014768-160014790 TGCAGGATAATGGGCACTTGTGG + Intronic
1018735823 6:166686545-166686567 TGCAGGATCAGATGCACTGATGG - Intronic
1023336044 7:39171692-39171714 TGCAGGAAAAGGAGCAATGATGG - Intronic
1023462254 7:40411465-40411487 TGCAGGATAGGTGGAACTGGAGG + Intronic
1025827464 7:65022150-65022172 TGCAGCAGAAGGATCACTTGAGG - Intergenic
1025915002 7:65858607-65858629 TGCAGCAGAAGGATCACTTGAGG - Intergenic
1027569510 7:79847032-79847054 TACAGGATAGGGGGTACTGGTGG - Intergenic
1028644267 7:93077436-93077458 TGGAGGAGAAGGAGCACTCTGGG - Intergenic
1030644671 7:112046806-112046828 TCCAGGCCATGGAGCACTGGAGG + Intronic
1031971477 7:128067989-128068011 GGCGGGAGAAGGTGCACTGGAGG - Intronic
1032705029 7:134414190-134414212 GGCAGGAAATGGAGCCCTGGGGG + Intergenic
1033120647 7:138664463-138664485 TGGAGGATTAGGGGCGCTGGAGG - Intronic
1034073299 7:148208445-148208467 TGATGGAAGAGGAGCACTGGAGG + Intronic
1036970464 8:13349159-13349181 GGCAGGATGAGGTGCAATGGGGG + Intronic
1038045411 8:23761779-23761801 TGGAGGATATTGAGCATTGGGGG - Intergenic
1039475981 8:37839626-37839648 AGCAGGAGAAGGGGCTCTGGGGG + Intronic
1039601488 8:38842088-38842110 GGCAGGGTAAGGAGGAATGGGGG - Intronic
1039804987 8:40990160-40990182 TGCAGGATAAGGAGCATAGGGGG + Intergenic
1040559806 8:48514439-48514461 TCCAGGACCAGGAGAACTGGTGG + Intergenic
1040830981 8:51676591-51676613 AACAGGATAGGGAGGACTGGTGG - Intronic
1041678637 8:60563462-60563484 TGAAGGTTAAAAAGCACTGGAGG + Intronic
1041781669 8:61584140-61584162 TGCAGGAGAAGGCACACTGCAGG + Intronic
1042757560 8:72233592-72233614 AGCAGGACAGGCAGCACTGGGGG - Intergenic
1043373505 8:79621082-79621104 TGCAGCACCAGCAGCACTGGTGG - Intronic
1043375624 8:79646362-79646384 AGCAGGACAAAGAGAACTGGGGG + Intronic
1043483577 8:80676872-80676894 TGCAGGAGGCGGAGCACAGGCGG + Intronic
1044372352 8:91426963-91426985 TGCTGGTTATGGGGCACTGGAGG + Intergenic
1046788210 8:118291293-118291315 TGCAGGAGAGGGAGAACTGGTGG + Intronic
1046876268 8:119258089-119258111 AGAAGGATAATGAGCAATGGAGG - Intergenic
1047807084 8:128371860-128371882 TGTAGGATAAGGAGAAATGGAGG + Intergenic
1048033864 8:130658320-130658342 TGTAGGAGAATGAGCACTAGAGG + Intergenic
1048128002 8:131658929-131658951 TCCAGGATAAGAACCACTGAGGG - Intergenic
1049313614 8:141947207-141947229 GGCAGGTAAAGGAGCACTGATGG - Intergenic
1049745522 8:144261648-144261670 AGCAGGATCTGGAGCGCTGGGGG - Exonic
1051008296 9:12377129-12377151 TGCAGGATTTGGACTACTGGTGG + Intergenic
1052172015 9:25411286-25411308 TCCAGGGTAAGGACCACTGTAGG + Intergenic
1052184974 9:25582183-25582205 TGCAGAATAATGAGAACTGGAGG - Intergenic
1056298466 9:85217502-85217524 AGCAGGCTAAGGAGGAGTGGGGG - Intergenic
1057249962 9:93493125-93493147 TGCAAAATAAGAAGCAATGGTGG + Intronic
1057408437 9:94794764-94794786 TGCAGGAAAGAGAGCACAGGAGG - Intronic
1060047017 9:120349302-120349324 TGCAGGAGACGGTGCGCTGGTGG - Intergenic
1060433269 9:123569473-123569495 TGCTGGAGCAGGAGCACTGTGGG - Intronic
1188930224 X:36100119-36100141 AGCAGGTAAAGGAGTACTGGAGG + Intronic
1190153595 X:47968857-47968879 TGCAGGATTAGTGGCATTGGAGG + Intronic
1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG + Intergenic
1198343080 X:135733703-135733725 TGCAGGTTAAGAAGCAATGAGGG + Intergenic
1198344909 X:135749592-135749614 TGCAGGTTAAGAAGCAATGAGGG - Intergenic