ID: 1099750892

View in Genome Browser
Species Human (GRCh38)
Location 12:86771187-86771209
Sequence CTGAGATCATGGTGGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1022
Summary {0: 1, 1: 0, 2: 10, 3: 146, 4: 865}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099750892 Original CRISPR CTGAGATCATGGTGGTGACA GGG (reversed) Intronic
900253147 1:1682173-1682195 CAGAGGTCATGCGGGTGACAGGG + Intronic
900279341 1:1855953-1855975 CTGAGAACACAGTGGTGAAAAGG - Intronic
900282026 1:1876118-1876140 CTGAAATCAAGGTGTTGGCAGGG - Intronic
900749598 1:4386834-4386856 CTGAGGTCAAGGTGATGACAGGG + Intergenic
900814612 1:4833874-4833896 GTGAGATTGTGGTGGGGACACGG + Intergenic
900819366 1:4874352-4874374 CTGAGATCAGGGTGTTGGCATGG + Intergenic
900950664 1:5856672-5856694 CTGAGATCAAGGTGAGGGCAGGG + Intergenic
901178948 1:7326703-7326725 CTGAAATCAAGGTGCTGGCAGGG - Intronic
901692640 1:10983493-10983515 CTGAGATCAAGGTGCAGGCAGGG - Intergenic
902110777 1:14076467-14076489 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
902456514 1:16537245-16537267 CCGAGATCAAGGTGCCGACATGG + Intergenic
902495651 1:16870666-16870688 CCGAGATCAAGGTGCCGACATGG - Intronic
902533723 1:17106925-17106947 CCGAGATCAGGGTGGTGGCATGG - Intronic
902704383 1:18194424-18194446 CTGAGATCAAGGTGTCGGCAGGG + Intronic
902722100 1:18310746-18310768 CTGAAATCAAGGTGTTGGCATGG + Intronic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904183143 1:28681118-28681140 GTGAGATGATGGTTGTGACGGGG + Intronic
904436588 1:30502527-30502549 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
904615112 1:31745434-31745456 CTGAGAGCCTGGTGGGGCCAGGG - Intronic
904955414 1:34279630-34279652 CTGAAATCAAGGTGGTGGGAGGG + Intergenic
904997019 1:34639215-34639237 TTGAGATCAAGGTGTTGGCAGGG - Intergenic
905097219 1:35483823-35483845 CTGAAATCAAGGTGTTGGCAGGG + Intronic
905514588 1:38552922-38552944 CTGAGATCAAGGTGGCACCATGG + Intergenic
905696084 1:39974662-39974684 GGGAGATCATGGTGGAGTCAAGG + Intergenic
906200234 1:43955446-43955468 CTGAAATCAAGGTGTTGGCAAGG + Intronic
907289124 1:53401668-53401690 CTGAAATCAAGGTGCTGTCAGGG - Intergenic
907289188 1:53402087-53402109 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
907734048 1:57094493-57094515 CTGAGGTCAGAGTGGTTACAGGG + Intronic
908333530 1:63096533-63096555 TTGAAATCAAGGTGTTGACAGGG - Intergenic
908390191 1:63677206-63677228 CTGAGATCGTGCTGGGGAGAAGG - Intergenic
908772796 1:67611367-67611389 CTGAGATCAGAGTGTCGACAGGG - Intergenic
908881850 1:68741876-68741898 ATGAGATTTTGGTGGGGACATGG - Intergenic
908886173 1:68791479-68791501 CTGAGATCAAAGTGTTGGCAAGG - Intergenic
908891119 1:68849096-68849118 CTGAGATCATGGCATTGGCAGGG + Intergenic
908941550 1:69441040-69441062 CTGAAATCATGGTGTTGGTATGG + Intergenic
909831588 1:80198191-80198213 CTGAGATAAAGGTGTTGGCAGGG + Intergenic
909891875 1:81017497-81017519 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
909952111 1:81733369-81733391 CTGAGACCAAGGTGCTGGCAAGG + Intronic
910055675 1:83031047-83031069 ATGAGATCTGGGTGGGGACATGG - Intergenic
910462111 1:87458602-87458624 CTGAAATCAAGGTGTTGACAGGG - Intergenic
910785462 1:90993205-90993227 TTGTTATCATGGTGGTGGCAAGG - Intronic
910988094 1:93026230-93026252 CTGAGATCAAGGTGTGGGCATGG + Intergenic
912272229 1:108223222-108223244 TTGTGTTCTTGGTGGTGACATGG + Intergenic
912405748 1:109436157-109436179 CTGAGATCATGGTGTCAGCAAGG - Intergenic
912464548 1:109862561-109862583 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
912949328 1:114109990-114110012 CTGACAGCATGGTGATGACAGGG + Intronic
913466745 1:119150704-119150726 CTGAAATCAAGGTGGAGGCAGGG - Intergenic
913715194 1:121526665-121526687 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
914420118 1:147521381-147521403 CTTAGCTTATGGTGCTGACAAGG + Intergenic
915083788 1:153370573-153370595 TGGTGATAATGGTGGTGACAAGG + Intergenic
915274991 1:154782382-154782404 CTGAGATCAGGGTGCCAACACGG + Intronic
915674476 1:157517635-157517657 CTAAAATCATGGTGTTGGCAGGG - Intronic
915976249 1:160391563-160391585 CTGACATCAAGGTGTTGGCAGGG - Intergenic
916099214 1:161379350-161379372 CCGAGAGCATGGTGGTGGCGCGG + Intergenic
916124193 1:161554724-161554746 CCAAGATCAAGGTGTTGACAGGG - Intergenic
916525413 1:165604672-165604694 CTGAGATTAAGGTGTTGGCAGGG - Intergenic
917224850 1:172770648-172770670 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
917610098 1:176680956-176680978 CTGAGTGGATGGTGGTGCCAAGG + Intronic
917674904 1:177309743-177309765 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
917938137 1:179889851-179889873 TTGAGATCATGTGGGTAACATGG - Intronic
918081389 1:181210336-181210358 CTGAGATCAAGGTGTTAGCAGGG + Intergenic
918511793 1:185320519-185320541 CTGAGATCAAGGTATTGTCAGGG + Intergenic
918966908 1:191362595-191362617 CTGAGATCAGGGTGCCAACATGG - Intergenic
919572092 1:199261478-199261500 CTGAGATCGAGGTGTTGGCAGGG - Intergenic
919826113 1:201504712-201504734 CTGAGATGGTGGTGGGGACAGGG + Intronic
919997040 1:202761733-202761755 TTGAGATCAAGGTGTTGGCAGGG - Intronic
920007201 1:202842074-202842096 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
920282909 1:204857785-204857807 CTGAGATCAAATTGTTGACAGGG + Intronic
920843021 1:209570721-209570743 CTGAGATCAAGGAGTTGTCAGGG + Intergenic
920864298 1:209738938-209738960 CTGAAATCAAGTTGTTGACAGGG - Intergenic
920911123 1:210217744-210217766 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
921128745 1:212200848-212200870 CTGATATGAAGGTGCTGACAAGG + Intergenic
921232288 1:213085097-213085119 CTGAAATCAAGGTGTTGGCAGGG + Intronic
921265961 1:213420808-213420830 CTGAGATCAAGGTGCTGGCAGGG + Intergenic
921350899 1:214233418-214233440 CTAAGATCAAGGTGCTGGCAGGG - Intergenic
922017351 1:221664055-221664077 CTGAAGTCAAGGTGTTGACAGGG - Intergenic
922030663 1:221794423-221794445 CTGATGTCATGCTGGTGGCAGGG + Intergenic
923000257 1:230001339-230001361 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
923001009 1:230006380-230006402 CTGAGATCAAGGTGCTGGCAGGG + Intergenic
923223325 1:231915899-231915921 CAGAGATCATGGGGATAACAAGG + Intronic
923349019 1:233085720-233085742 CTGAGAGCATGGTGGCCTCAGGG - Intronic
923615260 1:235532000-235532022 CTGAGATCAAGGTGACCACAGGG + Intergenic
923923627 1:238598291-238598313 CTGAGATCAAGGTGTCGGCAGGG + Intergenic
924333752 1:242966402-242966424 GTGAGATCAAGGTGTTGGCAGGG + Intergenic
1063133712 10:3199017-3199039 CTGAGATGATGGTGTGGGCAGGG - Intergenic
1063715301 10:8520868-8520890 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
1065490849 10:26280120-26280142 CTGAGATCACCGTGGAGGCAGGG + Intronic
1065619724 10:27568780-27568802 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1065634563 10:27717479-27717501 CTGAGATCATGGTACCTACATGG - Intronic
1065959805 10:30725383-30725405 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1066008089 10:31166400-31166422 CTGAGATCAGGGTGCTAGCATGG - Intergenic
1066160469 10:32722452-32722474 CTGGGATCAAGGTGTTGACATGG + Intronic
1066554187 10:36593100-36593122 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1067278021 10:44851621-44851643 CTGAGATCAGGGTGTCGGCAGGG + Intergenic
1067758451 10:49025124-49025146 CTGAGCTCAAGGTGCTGGCAGGG - Intronic
1068234694 10:54218616-54218638 CTGAGATCAAGGTGCTTTCATGG - Intronic
1068481859 10:57599897-57599919 CTGTGCCCAGGGTGGTGACAGGG - Intergenic
1069268762 10:66496894-66496916 CTGAGATTAAGGTGTTGAAAGGG + Intronic
1069576941 10:69537476-69537498 CTGAGATCAAGGTGTCGTCAGGG + Intergenic
1069670227 10:70196119-70196141 CAGAGAGCAAGGTGCTGACAGGG - Intergenic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1069760374 10:70806523-70806545 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1069970970 10:72168843-72168865 CTAAGATCAAGGTGCTGGCAGGG - Intronic
1070548099 10:77468643-77468665 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1070553764 10:77512795-77512817 CCAAGATCATGGTGTTGACAGGG - Intronic
1070843561 10:79504652-79504674 ATGAGGTCATGGTGAGGACAGGG - Intergenic
1070930106 10:80254948-80254970 ATGAGGTCATGGTGAGGACAGGG + Intergenic
1070952982 10:80445680-80445702 CTAAGCAGATGGTGGTGACAAGG - Intergenic
1071131556 10:82399522-82399544 CTGAGATCAGGGTGCCTACATGG + Intronic
1071465897 10:85939422-85939444 CTAAAATCAAGGTGTTGACAGGG + Intronic
1071804579 10:89103114-89103136 CTGAGACCAAGGTGTTGGCAGGG + Intergenic
1072721264 10:97782365-97782387 CTGAGACCAGGCTGCTGACATGG + Intergenic
1072985161 10:100133047-100133069 CTGAGATCAAGGTGTCGGCAGGG - Intergenic
1073059124 10:100723010-100723032 CTGAGATCTTGCTGGTTCCAGGG + Intergenic
1073615552 10:104991338-104991360 CTGAGATCAAGGTGTTGGCAGGG + Intronic
1073651858 10:105369177-105369199 CTGAGATCAAGATGTTGGCAGGG - Intergenic
1074062924 10:109984343-109984365 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1074404648 10:113170360-113170382 CTGAAATCAAAGTGGTGGCAGGG + Intergenic
1074490471 10:113935170-113935192 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1074507768 10:114086637-114086659 CAGAGAGCATGGTGGTGGGAGGG + Intergenic
1075919869 10:126201680-126201702 ATGAGAGAGTGGTGGTGACAAGG + Intronic
1075955097 10:126516788-126516810 CTAAAATCAAGGTGGTGGCAGGG + Intronic
1076303079 10:129442450-129442472 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1077166597 11:1143404-1143426 CAGATATCATGAGGGTGACAAGG + Intergenic
1077278829 11:1732787-1732809 CTGAGTTCATGTTGGGGAAATGG - Exonic
1077289937 11:1784375-1784397 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1077555298 11:3223061-3223083 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1077878197 11:6325270-6325292 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1078005865 11:7531766-7531788 CTAAGATCAGGGTGTTGGCAGGG + Intronic
1078153274 11:8776905-8776927 CAGAGATGATGGGGGTCACATGG + Intronic
1078550972 11:12280473-12280495 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1078916419 11:15782907-15782929 CCGAAATCAAGGTGCTGACAGGG - Intergenic
1079089098 11:17468253-17468275 GTGACATCATGGTGTTGTCAGGG - Intronic
1079284116 11:19114003-19114025 CTGAGATGAAGGTGTTGACAGGG - Intergenic
1079569883 11:21929988-21930010 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1079962752 11:26944129-26944151 CTGAGATCAGGGTGCCAACATGG - Intergenic
1080430358 11:32192378-32192400 CTGAGGTCAGGGTGTTGACCAGG - Intergenic
1080622476 11:33998071-33998093 CTGAGAGTATGGGGGTGGCAGGG + Intergenic
1080898535 11:36466292-36466314 CTGAAATCAAGGTGGTGTCAAGG + Intergenic
1080984195 11:37442308-37442330 CTGAGATCAGGGTGCCGGCATGG + Intergenic
1081135788 11:39438848-39438870 CTGAGATCATGGTGCCAGCATGG + Intergenic
1081259361 11:40939865-40939887 CAGAAATCATTGTGATGACAGGG + Intronic
1081417911 11:42837741-42837763 CTAAGATCAAGGTGTTGGCATGG - Intergenic
1081480881 11:43487777-43487799 CTGAGATCAAAGTGCTGGCAGGG + Intronic
1081811447 11:45916462-45916484 GTGAGATCATGTTGGGGAGAGGG - Intronic
1082119449 11:48362566-48362588 CTCAGACCATGGTGGTCTCAGGG - Intergenic
1082254850 11:50022595-50022617 CTCAGAGCATGGTGGTCTCAGGG + Intergenic
1082651555 11:55800163-55800185 ATGAGATCATGGTCTTTACAGGG + Intergenic
1083043155 11:59707686-59707708 CTGAGATCAAGGTATTGGCAGGG - Intergenic
1083708140 11:64530687-64530709 CTGACACCAAGGTGGTGGCAGGG - Intergenic
1083791464 11:64988939-64988961 ATAAGATATTGGTGGTGACAGGG + Exonic
1083803886 11:65062320-65062342 CTGTGAGCACGGTCGTGACATGG - Intergenic
1084068144 11:66717392-66717414 CTGAGATGCTGGTGCTGAGACGG - Intronic
1084158329 11:67328724-67328746 CTGAGATCAAGGTGTTGAGAGGG - Intronic
1084561604 11:69908730-69908752 CTGAGATCACGGTGTCGGCAGGG - Intergenic
1084570868 11:69959157-69959179 CTCAGGTCATGGTGGAGATAAGG + Intergenic
1085922899 11:80980354-80980376 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1086195009 11:84127452-84127474 CTGAAATCAAGGTAGTGGCAAGG + Intronic
1086479531 11:87219342-87219364 CTAAGATCAAGGTGCTGTCAGGG + Intronic
1086852430 11:91825653-91825675 CTGAGATCAGGGTATTGGCAGGG + Intergenic
1087420060 11:97911395-97911417 CTGATATCATGGTGGTGGCATGG + Intergenic
1088712629 11:112522252-112522274 CTGAAATCAAGGTGCTGACAGGG - Intergenic
1088980024 11:114854060-114854082 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1089111891 11:116063745-116063767 CTAAGATCAAGGTGCTGGCAGGG + Intergenic
1090170163 11:124594868-124594890 CAGAGCTAATGGAGGTGACATGG - Intergenic
1090773573 11:129944143-129944165 TTGAGATCATGGCGTTGGCAGGG - Intronic
1090906197 11:131076629-131076651 CTGAGAACAAGGTGTTGGCAGGG + Intergenic
1091269815 11:134300150-134300172 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1091636438 12:2200569-2200591 CTGAGGATACGGTGGTGACAGGG + Intronic
1091815165 12:3432169-3432191 CTGAGATGATGGTGATGGCAGGG + Intronic
1091891492 12:4058563-4058585 CTGAAATCAAGGTGTTGCCAGGG + Intergenic
1092056037 12:5508717-5508739 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1093685411 12:22048471-22048493 CTGAGATCATCCTAGGGACATGG - Intronic
1093747247 12:22755849-22755871 CTGAGATCACGGTGCTGGCAGGG - Intergenic
1094320617 12:29178918-29178940 CTGAGATCAAGATGCTGGCAGGG + Intronic
1094412123 12:30177714-30177736 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1095158037 12:38882401-38882423 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1095476767 12:42593568-42593590 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1095695885 12:45143716-45143738 CTGAGATCAGGGTGCTAACATGG + Intergenic
1095726489 12:45459084-45459106 CTGAGATCAAGATGTTGGCAGGG - Intergenic
1096035620 12:48467310-48467332 CTGAAATCAAGGTGTCGACAGGG - Intergenic
1096222005 12:49836089-49836111 CTGAAATCAAGGTGTTGGCAGGG + Exonic
1096482207 12:51949993-51950015 CTGAAACCATGGTGTTGGCAGGG - Intergenic
1097333006 12:58352751-58352773 ATGAGATCATGATGGTGGGAAGG - Intergenic
1097440446 12:59601706-59601728 CTGAGATCAGGGTGCTGGCATGG + Intronic
1097626164 12:62003057-62003079 GAGAGATGATGGTGGTGAGAGGG - Intronic
1097709211 12:62900024-62900046 CTGTGATCAGGGTGCTGGCATGG - Intronic
1097974557 12:65670742-65670764 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1097993042 12:65856662-65856684 CTGACATCATGGTGTTGGCAGGG + Exonic
1098036543 12:66308585-66308607 CTGAGATCAAGGTGTGGACAGGG + Intronic
1098569657 12:71974348-71974370 CTAAAATCAGGGTGTTGACAGGG + Intronic
1098976641 12:76908919-76908941 CTGAGATCAAGGTGCCAACAGGG - Intergenic
1099750892 12:86771187-86771209 CTGAGATCATGGTGGTGACAGGG - Intronic
1099829201 12:87818085-87818107 CTGAAATCAAGGTTTTGACAAGG - Intergenic
1099904706 12:88758455-88758477 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1099972748 12:89516719-89516741 CTGAAATCATGGTGTTGGCCGGG + Intronic
1100785600 12:98074702-98074724 CTGAGTTCATGGAGTTTACACGG - Intergenic
1100882017 12:99029817-99029839 TTGAGAACATGGTGGAGCCAGGG - Intronic
1102469207 12:113150074-113150096 CTGAGACCATGGTGATGCCTCGG - Intronic
1102749308 12:115278346-115278368 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1102868588 12:116394222-116394244 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1103272552 12:119685996-119686018 CTGGCATCTTGGTGGTCACACGG + Exonic
1103870711 12:124089393-124089415 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870715 12:124089444-124089466 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870719 12:124089495-124089517 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870723 12:124089546-124089568 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870727 12:124089597-124089619 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870731 12:124089648-124089670 CTGATTTCCTGGTTGTGACATGG - Intronic
1103870735 12:124089699-124089721 CTGATTTCCTGGTTGTGACATGG - Intronic
1103998423 12:124844712-124844734 CTGAGATCAGGATGTTGGCAGGG - Intronic
1104146558 12:126039686-126039708 CCAAGATCGTGGTGTTGACAGGG + Intergenic
1104381639 12:128312715-128312737 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1104510581 12:129374183-129374205 CTGAGATCAGGGTGCTAGCATGG + Intronic
1104654235 12:130561181-130561203 CCGAGATCAAGGTGTTGGCAGGG - Intronic
1104657472 12:130584195-130584217 GTGAGGTGATGGTGGTGATAAGG - Intronic
1105444258 13:20438724-20438746 CTGACAACCTGGTGGTGCCAAGG + Intronic
1105498154 13:20948636-20948658 TGGTGATCATGGTGGTGTCATGG - Intergenic
1106021979 13:25924314-25924336 CAAAGATCAAGGTGTTGACAGGG + Intronic
1106465162 13:30006939-30006961 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1106470534 13:30050290-30050312 CTGAAATCAAGGTGTTGGCAAGG + Intergenic
1106882193 13:34143757-34143779 CTGAGATCAAGGTGTGGTCAGGG - Intergenic
1107043773 13:35974820-35974842 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1107500027 13:40964370-40964392 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1108258459 13:48632982-48633004 CTGAGATCATGGTGTCAGCAGGG - Intergenic
1108267599 13:48728351-48728373 CCAAGATCAAGGTGCTGACAGGG + Intergenic
1108603827 13:52017419-52017441 CTGAGATTTGGGTGGGGACATGG - Intronic
1108694245 13:52888746-52888768 CTCAGCTAATGGTGGGGACATGG + Intergenic
1108710003 13:53024074-53024096 CTGAGATCAGGATGTCGACATGG + Intergenic
1108806431 13:54162316-54162338 CTTAGATCAAGGTGTTGGCAAGG + Intergenic
1109032965 13:57217322-57217344 ATGAGATCAAGGTGTTGGCAGGG - Intergenic
1109048838 13:57450993-57451015 CAGAGATCAAGGTGCTGACAGGG + Intergenic
1109135978 13:58651557-58651579 CTGAAATCAGGATGGTGATAAGG + Intergenic
1109215081 13:59580516-59580538 CTGAGATCATGGTGCCAGCATGG - Intergenic
1109823554 13:67688314-67688336 CTGAAATCAAGATGTTGACAAGG + Intergenic
1110175609 13:72552075-72552097 CTGAGATCAAGCTGTTGGCAGGG + Intergenic
1110379574 13:74835038-74835060 CTGAGATCAAGGTGTTGCCAGGG + Intergenic
1110508656 13:76321879-76321901 CTGAGATCAAGGTGTTAGCAGGG - Intergenic
1110509173 13:76328773-76328795 CTGACATCAAGGTGTTGGCAGGG + Intergenic
1110509623 13:76334088-76334110 TTGAAATCACGGTGTTGACAGGG - Intergenic
1110525492 13:76531872-76531894 CTGAGATCAAGTTGCTGGCAGGG + Intergenic
1110837042 13:80094875-80094897 CTGAGATCAAAGTGTTGGCAAGG + Intergenic
1111816281 13:93157216-93157238 CTGAGATCAATGTGTTGGCAGGG + Intergenic
1111862228 13:93722723-93722745 CTGAGATCAAGATGTTGACAGGG + Intronic
1111948880 13:94693987-94694009 CTGAGATCAGGGTGGCAGCATGG + Intergenic
1112284101 13:98088755-98088777 CTGAGGTCAAGGTGTTGGCAGGG + Intergenic
1112574965 13:100627401-100627423 CTGAGATCACGGTGTGGGCAGGG + Intronic
1112594122 13:100792298-100792320 ATGAGATTTGGGTGGTGACACGG + Intergenic
1113014429 13:105811943-105811965 CTGAAATCAAGGTGTTGGCATGG + Intergenic
1113143421 13:107179726-107179748 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1113603466 13:111587941-111587963 CTGAGATCAAGGTGCTGGCAGGG + Intergenic
1113704962 13:112424197-112424219 CAGAGATGCTGGTGGAGACAGGG - Intronic
1114046689 14:18881828-18881850 CAGATCTCATGGTGGTGCCAAGG + Intergenic
1114117522 14:19637619-19637641 CAGATCTCATGGTGGTGCCAAGG - Intergenic
1115502848 14:34064673-34064695 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1115851388 14:37592675-37592697 CTGAGTTCATGTTGCTGACCGGG + Exonic
1116321853 14:43478326-43478348 CTGAGATCATGGTGCCAAAATGG + Intergenic
1116870753 14:50067422-50067444 CTGAGATCCAGGTGTTGACGGGG + Intergenic
1117352563 14:54895882-54895904 CTGTGACCAGGGTGGTGTCAGGG - Intronic
1117744239 14:58851872-58851894 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1118040319 14:61909368-61909390 CTGAAATCAGGGTGTTGGCAGGG + Intergenic
1118309919 14:64684536-64684558 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1118333263 14:64830850-64830872 ATGACACCATGGTGGGGACAGGG - Intronic
1118409308 14:65461105-65461127 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1118655170 14:67939682-67939704 CTGAGATCAGGGTGGAAGCATGG + Intronic
1118742795 14:68752617-68752639 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1118839679 14:69501029-69501051 CTGGGATCCTGGTGGGCACAGGG + Intronic
1119128472 14:72150336-72150358 CTGGAATCAAGGTGTTGACAGGG - Intronic
1119153561 14:72387833-72387855 CCAAGATCATGGTGGGGGCAGGG + Intronic
1119165598 14:72489796-72489818 CTGATATCAAGGTGTTGGCAGGG - Intronic
1119456501 14:74760525-74760547 CTGAAATCATGGTATTGGCAGGG + Intergenic
1119508005 14:75189556-75189578 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1119616389 14:76101672-76101694 CCAAGATCAAGGTGTTGACAGGG - Intergenic
1119767892 14:77201889-77201911 CTGAGATCATTGCACTGACAGGG + Intronic
1120212130 14:81643530-81643552 CTGAGATCAGGGTGCCAACACGG - Intergenic
1120217849 14:81699801-81699823 CTGAGATCAAGGTGTAGGCAGGG + Intergenic
1120284887 14:82487144-82487166 CTGATTTCACAGTGGTGACAAGG + Intergenic
1120437308 14:84496957-84496979 GACAGATCATGGTTGTGACAGGG - Intergenic
1121221096 14:92285991-92286013 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1121403487 14:93703312-93703334 CTGAGATCAAGGTGTCGGCAGGG + Intronic
1121488782 14:94343116-94343138 CTGGGAACATGTTTGTGACATGG - Intergenic
1121555674 14:94834898-94834920 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1121818363 14:96945184-96945206 CTGATAACATGCTGGTAACATGG - Intergenic
1121839276 14:97119118-97119140 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
1122845900 14:104498717-104498739 CCGAGGTCAAGGTGGTGGCAGGG + Intronic
1123027635 14:105435035-105435057 CTGAGATCAGGGATGTGCCAAGG - Intronic
1124122204 15:26897421-26897443 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1124126415 15:26941672-26941694 CTGGGATCAGGGTGTTGGCAGGG + Intronic
1124338386 15:28874048-28874070 CTGAGATCAAGGTGCAGACAGGG + Intergenic
1124821561 15:33051440-33051462 CCGACATCCTGGTGGTGGCAGGG - Intronic
1125556235 15:40587667-40587689 CTGAGATCAAGGTGTCAACAGGG - Intergenic
1126303468 15:47226265-47226287 CTGAGATCAAGATGTTGGCAAGG - Intronic
1126326957 15:47489273-47489295 CTGACATCAAGGTGTTGGCAGGG - Intronic
1126336473 15:47590819-47590841 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1126479863 15:49106120-49106142 CTGAAATCAAGGTGCTGGCAGGG + Intronic
1127214455 15:56810054-56810076 CCGAGATCAAGGTGTTAACAGGG + Intronic
1127935828 15:63636632-63636654 CTAAAATAATGGTGATGACAAGG + Intronic
1128243258 15:66115900-66115922 CTGAGATCCAGGTGTTGGCAGGG - Intronic
1129060677 15:72858125-72858147 CTGAGATCAGGGTGCCGGCATGG - Intergenic
1129063398 15:72880406-72880428 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1129228962 15:74185953-74185975 TTGAGATTCTGGTGGTGACACGG - Intronic
1129703383 15:77780854-77780876 CTGAGATCAGGGTGCCGGCATGG - Intronic
1130093127 15:80837793-80837815 CTGAGCTCATGGTATAGACATGG + Intronic
1130201915 15:81839055-81839077 CTGAGATCATGGTGCCAACAGGG - Intergenic
1130320481 15:82837012-82837034 CTAAAATCAAGGTGTTGACAGGG + Intronic
1130446966 15:84012253-84012275 CCAAGATCAAGGTGGTGGCATGG + Intronic
1130677298 15:85964606-85964628 CTGAGATCAAAGTGTTGGCAGGG + Intergenic
1130877295 15:88025670-88025692 CTGAAATCAAGGTGTTGACAGGG - Intronic
1130890560 15:88130066-88130088 CTGAGATAAAGGTGTTGGCAGGG - Intronic
1131067249 15:89442361-89442383 CAGAGACCATGGTGGTGGCTGGG + Intergenic
1131352418 15:91713303-91713325 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1131359280 15:91775206-91775228 CTGAGATCAAGGTGAGGGCAAGG - Intergenic
1131362152 15:91802652-91802674 CTCAGATTTTGGGGGTGACATGG + Intergenic
1131434084 15:92409206-92409228 CTGAGATCAAGCTGATAACAAGG + Intronic
1131902578 15:97104404-97104426 CTGAGATCAAGGTGCTGGCAGGG - Intergenic
1131904870 15:97132329-97132351 CTGAAATCACGGTGTTGATAGGG + Intergenic
1132386385 15:101403646-101403668 CTGAGAAGCTGGGGGTGACAGGG - Intronic
1133205511 16:4230968-4230990 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1133418658 16:5626251-5626273 CAGAGATCAAGGTGTTGGCAGGG + Intergenic
1133631224 16:7623741-7623763 CTGAGATCATGGTGTTGGCAGGG + Intronic
1133717801 16:8466151-8466173 CTGAAATCATGGTGTGCACAGGG + Intergenic
1134217504 16:12327413-12327435 CTGAGATCAAGGTGTCGGCAGGG + Intronic
1134569442 16:15278957-15278979 CTGAGATCAGGGTGCTGGCATGG + Intergenic
1134732935 16:16477092-16477114 CTGAGATCAGGGTGCTGGCATGG - Intergenic
1134909625 16:18012975-18012997 CTGTGATCACGGTGGTGGCTGGG - Intergenic
1134934504 16:18234879-18234901 CTGAGATCAGGGTGCTGGCATGG + Intergenic
1135519038 16:23159356-23159378 CTGAGATTAAGGTGTTGGCAGGG + Intergenic
1135607471 16:23836526-23836548 CTGGGACCAGGGTGGGGACAGGG - Intronic
1135820463 16:25680698-25680720 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1136065953 16:27758717-27758739 CTGAGACCAGGGTGCTGAGAAGG - Intronic
1136286504 16:29247240-29247262 CTGAGCTCTTGGTGGAGACTTGG - Intergenic
1137623172 16:49890260-49890282 CTCACATCATGGTGGTCTCAGGG + Intergenic
1138343434 16:56305755-56305777 CTGAGATCAGGGTGCTGGCAGGG + Intronic
1138375625 16:56562107-56562129 CTGAGCTTAGGTTGGTGACAGGG - Intergenic
1138425491 16:56929380-56929402 CTGAGATCAAGGTGTCGGCAGGG - Intergenic
1138545897 16:57719366-57719388 CTGAGATCAAGGTGTGGACAGGG + Intronic
1139049172 16:63102170-63102192 CTAAGATCAAGGTGCTGTCAGGG - Intergenic
1139365412 16:66429435-66429457 CTGGGATCCTGGAGGTGGCAAGG + Intronic
1139416448 16:66815095-66815117 CAGAGAGCATGCTGGGGACAAGG - Intronic
1140266150 16:73422928-73422950 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1140268571 16:73442237-73442259 CCGAGATCAAGGTGTTGGCAGGG + Intergenic
1140412155 16:74747751-74747773 CTGAGAGCAAGGTGTTGGCAGGG - Intronic
1140942021 16:79730787-79730809 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1141055673 16:80811470-80811492 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1141335771 16:83153733-83153755 CTGAGATCAAGGTAATGCCAGGG - Intronic
1142092091 16:88219814-88219836 CTGAGCTCTTGGTGGAGACTTGG - Intergenic
1142411466 16:89919161-89919183 CTTAGTTCATGGTGCTGCCAGGG - Exonic
1203142448 16_KI270728v1_random:1777201-1777223 CTGAGATCAGGGTGTGGGCAGGG - Intergenic
1142535642 17:615982-616004 ATGAGATGATGGTGGGGACCAGG + Intronic
1142562682 17:820131-820153 CTGTGATGATGGTGGTTACGTGG + Intronic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1143287857 17:5804390-5804412 CTGAGATCAGGGTATTGGCAAGG + Intronic
1143474305 17:7194045-7194067 CTCAGAGCATGGGGGTGGCAGGG - Intronic
1143832823 17:9665945-9665967 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1144444121 17:15310588-15310610 CTGAGATCAAGGTGCCGGCAGGG - Intronic
1144933164 17:18876697-18876719 GTGAGATGATAGTGGTGAGAGGG + Intronic
1145210062 17:21006080-21006102 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1146001273 17:29131986-29132008 CTGAGATCTTGCTGGAGGCAGGG + Intronic
1146924847 17:36737026-36737048 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1148368610 17:47076052-47076074 CTGAAATAATGGTGTTAACAGGG - Intergenic
1148717458 17:49726030-49726052 CTGAGATCAAGGTGTTGGTAGGG - Intronic
1148969254 17:51464903-51464925 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1148994917 17:51701112-51701134 CTGATATCAAGGTGCTGGCAGGG + Intronic
1150932895 17:69604277-69604299 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1151249019 17:72819362-72819384 CTGAAATCAAGGTGGCCACAGGG - Intronic
1151385290 17:73751599-73751621 CTGAGATCAAGGTGTAGGCAGGG + Intergenic
1151517241 17:74604551-74604573 CTGAAATCAAGGTGTTAACAGGG + Intergenic
1151875135 17:76863681-76863703 CTGAAATCAAGGTGTTGATACGG - Intergenic
1152084963 17:78212338-78212360 CAGAGGCCATGGTGGTGCCAGGG + Intergenic
1153418073 18:4872416-4872438 CTGAGATCAGGGTGGCAGCATGG - Intergenic
1153440693 18:5116305-5116327 ATGAGATTAGGGTGGGGACATGG - Intergenic
1153704075 18:7727127-7727149 CTTAAATAATGTTGGTGACAGGG - Intronic
1153722166 18:7916490-7916512 CTGAGATCAGGGTGCCAACACGG + Intronic
1153732939 18:8033865-8033887 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1153803276 18:8690253-8690275 GTGAGATGATGGTGGAGAGAAGG - Intergenic
1153885526 18:9461303-9461325 CTGAGATCAAGGTGTTGACAGGG - Intergenic
1155305411 18:24473389-24473411 TTGAAATCAAGGTGCTGACAGGG + Intronic
1155529794 18:26755248-26755270 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1155621308 18:27783792-27783814 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1155626342 18:27839200-27839222 CTGAGATCAAGGTGCTAGCATGG - Intergenic
1156048385 18:32903011-32903033 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
1156620373 18:38844596-38844618 CTGAGATCAAGGTGGCAGCAAGG - Intergenic
1156801635 18:41122069-41122091 ATGAGATCTGGGTGGGGACACGG - Intergenic
1156973097 18:43181885-43181907 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1157195594 18:45617859-45617881 CTGAGATCCTGGTGGCAAGATGG + Intronic
1157324560 18:46659232-46659254 CTGAGAACCTGGTGGTGAGCGGG + Intergenic
1157392084 18:47311360-47311382 CTGAAATCATGGTGTTGGCCCGG + Intergenic
1157429084 18:47608637-47608659 CTCAGAAAATGGAGGTGACAAGG - Intergenic
1157829445 18:50843412-50843434 CTGAGATCAAGGTGTTCATATGG + Intergenic
1158467695 18:57705708-57705730 CTGAAATCTTGGTGTTGGCAGGG - Intronic
1158723457 18:59946792-59946814 CTGAGATCAAGGTGTCGGCAGGG + Intergenic
1158799540 18:60890148-60890170 CTGAAATCAAGGTGTTGAGATGG + Intergenic
1158803737 18:60945127-60945149 CTGAAATCAAGGTGTTGTCAGGG + Intergenic
1158926109 18:62262865-62262887 CTGAGATCAAGGTGTTGGCAGGG + Intronic
1159603740 18:70453169-70453191 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1159893634 18:73975936-73975958 CTGGGATTATGGTGGAGAAAAGG - Intergenic
1160028912 18:75241742-75241764 CTGAGATCAAGGTGTTGGCAAGG + Intronic
1160042772 18:75360714-75360736 CCCAGATCATGGTGTTGGCAGGG + Intergenic
1160083224 18:75750987-75751009 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1160217545 18:76946092-76946114 ATGAGATCTGGGTGGGGACACGG - Intronic
1160353240 18:78203325-78203347 CTGAGAGCATGCAGGAGACACGG + Intergenic
1161172945 19:2822381-2822403 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1162471562 19:10875169-10875191 CTGAAATCATGGTACTGGCAGGG + Intronic
1162554711 19:11379636-11379658 TTGAGATGAGGGAGGTGACAGGG - Intronic
1162899807 19:13788000-13788022 CTCAGATGAAGGTGGAGACAAGG - Intergenic
1164484893 19:28646814-28646836 CTGAGATCAAGGTGTTGACAGGG - Intergenic
1164525798 19:29012637-29012659 CTGAGATCAAGGTCTTGGCAGGG + Intergenic
1164847710 19:31448636-31448658 CTGAGAGCATGGCGGCTACAGGG + Intergenic
1165999486 19:39869937-39869959 CTGACATCAAGGTGTTGGCAAGG - Intronic
1166816865 19:45551569-45551591 CTGAAACCAAGGTGCTGACAGGG - Intronic
1167533343 19:50032729-50032751 CTAAGATCAGGGTGTTGGCAGGG + Intronic
1167554158 19:50182721-50182743 TTGAGATAATGGTGCTGAAAGGG + Intergenic
1168682269 19:58324655-58324677 CTCAGATCAGGGTGGTCAAACGG - Intergenic
925004756 2:433347-433369 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
925538936 2:4945426-4945448 CTGAGATCAGGGTGTTGGTAGGG + Intergenic
925641188 2:5987099-5987121 CAGAGATCATGTGTGTGACAAGG - Intergenic
925790069 2:7475613-7475635 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
925843164 2:8011287-8011309 CTGAGATCAAGGTGTCCACAAGG + Intergenic
925965351 2:9060487-9060509 CCGAGATCAAGGTGGTGGCAGGG - Intergenic
925973721 2:9126113-9126135 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
926355895 2:12040380-12040402 CTGAGCTCCTGGTGTTGGCAGGG + Intergenic
926653466 2:15371699-15371721 CTGAAATAATGATGGGGACAAGG - Intronic
926699843 2:15796341-15796363 CTGAGATCCAGGAGGGGACAGGG + Intergenic
926966673 2:18422539-18422561 CTGAGATGATGCTGGTGACTAGG + Intergenic
926968136 2:18438497-18438519 CTGAGATCAGGGTGTCCACATGG - Intergenic
927756635 2:25713736-25713758 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
928381863 2:30824858-30824880 CTGAGATCAAGATGTTGACAGGG - Intergenic
929281683 2:40087192-40087214 CTGAGACAGTGGTGGTCACAAGG - Intergenic
929853492 2:45614597-45614619 CTGAGAACATGGGGCTGAGAGGG - Intergenic
929921771 2:46177408-46177430 CTGAAATCAAGGTGTTGGCAGGG + Intronic
930103405 2:47619970-47619992 CTGAAGTCACGGTGTTGACAGGG - Intergenic
930192873 2:48478456-48478478 CTGAGATGACGATGGTGGCAGGG + Intronic
930397265 2:50838793-50838815 CTGAAATCATGGTACTGACAGGG - Intronic
930760441 2:55029224-55029246 CTAAGATCAAGGTGCTGGCAAGG - Intronic
931071729 2:58659145-58659167 CTGAAATCAAGGTGTTGGCATGG + Intergenic
931163320 2:59718142-59718164 CTGAGATCAAGGTGTTAGCAGGG + Intergenic
931443866 2:62310283-62310305 CAGAAATCAAGGTGGTGGCAGGG + Intergenic
931519252 2:63077436-63077458 CTGAGATCAAGGTGTTGTCGGGG + Intergenic
931752937 2:65346872-65346894 CAGGGATCATGGTGGAGAGATGG - Intronic
932638156 2:73411345-73411367 CTGAAATCAAGGTGTTGGCAGGG - Intronic
933688848 2:85163693-85163715 CTGAGATCAAGGTGTCGGCAGGG + Intronic
933936065 2:87204814-87204836 CTGAGATCAAAGTGCTGATAAGG + Intergenic
933947592 2:87300128-87300150 CTGAGCCCATGGTGGGAACAAGG - Intergenic
934705593 2:96476201-96476223 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
934926703 2:98386940-98386962 CTAAAATCAAGGTGTTGACAGGG - Intronic
935143121 2:100373016-100373038 CTGAAATCAAGGTGGTAGCAAGG + Intergenic
935193380 2:100795933-100795955 CTGAGATCAAGGTGCTGGCATGG + Intergenic
935331651 2:101981751-101981773 CTGACATCAAGGTGCTGGCAGGG + Intergenic
936063465 2:109313220-109313242 CTGATATCATGCCGGTGTCAAGG - Intronic
936126039 2:109789828-109789850 CTGGGAGCATGGAGGTGAAAAGG + Intergenic
936218654 2:110581640-110581662 CTGGGAGCATGGAGGTGAAAAGG - Intergenic
936230053 2:110692650-110692672 CTGAGCTCAAGGTGTTGACAGGG - Intergenic
936265305 2:111000570-111000592 CTGAAATCATGGTGGCAGCAGGG + Intronic
936332604 2:111561449-111561471 CTGAGCCCATGGTGGGAACAAGG + Intergenic
936357083 2:111761015-111761037 CTGAGATCAAAGTGCTGATAAGG - Intergenic
937015027 2:118597230-118597252 CCGAGATCAAGGTGTTGGCAAGG + Intergenic
937425670 2:121796571-121796593 CTAGGATCAAGGTGGTGGCAAGG + Intergenic
937427495 2:121812307-121812329 CTGAGATTTGGGTGGGGACACGG - Intergenic
937768183 2:125686132-125686154 CTGACATCAAAGTGTTGACAGGG + Intergenic
938725810 2:134108129-134108151 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
938920863 2:135993383-135993405 CTGAGATCAAGATGTTGGCAGGG - Intergenic
939332474 2:140782499-140782521 CTGAGATCAAGGTGTTGGCAGGG - Intronic
939693684 2:145297274-145297296 CTGAGATTAAGGTGTTGGCAGGG + Intergenic
939712778 2:145543547-145543569 CTGAGATCAAGGTGATGTCAGGG - Intergenic
940013554 2:149080128-149080150 CTGAAATCAAGGTGATGGCAAGG + Intronic
940073646 2:149717335-149717357 CTGAGATCAAGGTGTTGAAAGGG + Intergenic
940256529 2:151736704-151736726 CTAAGATCAGGGTGCTGGCATGG - Intergenic
940688661 2:156885924-156885946 CTGAAATCAAGGTAGTGATAGGG - Intergenic
940989095 2:160079857-160079879 TTGAGATCAAGATGTTGACAGGG - Intergenic
942280988 2:174363861-174363883 ATGAGATCTGGGTGGGGACACGG + Intronic
942526584 2:176859760-176859782 CTGAGATCAAGGTGACGGCAGGG + Intergenic
942588224 2:177510189-177510211 CTGAGATCAGGATGTTAACATGG + Intronic
942853462 2:180518687-180518709 CTGAGATCAGGGTGTTAGCAGGG - Intergenic
943380542 2:187139681-187139703 CTGAGATCAAGGTTATGGCAGGG + Intergenic
943665142 2:190601311-190601333 CTGAGATCAGGGTGCAGACAGGG - Intergenic
943672661 2:190680117-190680139 GGGAGTTCAGGGTGGTGACAGGG - Intronic
945655047 2:212612660-212612682 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
945831842 2:214796586-214796608 CTAAGATCAAGATGATGACAGGG - Intronic
946171161 2:217896580-217896602 CTGAAATCAAGGTGTTGACGGGG - Intronic
946695572 2:222355090-222355112 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
946965742 2:225035765-225035787 CTGAGATCATGGTGCTAACATGG + Intronic
947067160 2:226240639-226240661 CTGAGATCATGGTGTCAGCAGGG - Intergenic
947369315 2:229428296-229428318 CTGGGATGAGAGTGGTGACAGGG + Intronic
947499560 2:230661980-230662002 CTGAGATCCAGGTGTTGACAGGG + Intergenic
947569487 2:231221111-231221133 CTGAAATCAAGGTGTTGGCAGGG + Intronic
947676226 2:231983292-231983314 GTGAGATCAAGGTGTTGGCAGGG + Intronic
947867083 2:233406013-233406035 CTGAAATCATGGTGTTGGCAGGG + Intronic
948147847 2:235721617-235721639 CTGAAATCAAGGTGTTGACGGGG + Intronic
948243460 2:236457831-236457853 CTGACATCAAGGTGCTGGCAGGG - Intronic
948276662 2:236714197-236714219 CTGAGATCAAAGTGGTGGCAGGG - Intergenic
948307561 2:236960551-236960573 CTGAGATCAAGAATGTGACAGGG - Intergenic
1168787401 20:551845-551867 CTGAGATCAAGGTGCTGTCAGGG - Intergenic
1168815360 20:733073-733095 CTGAAATCAAGGTGCTGGCAAGG - Intergenic
1169895783 20:10503701-10503723 CTGATATCAAGGTGTTGGCAGGG + Intronic
1170015292 20:11774486-11774508 CTGAAATCAAGGTGTTGACAGGG - Intergenic
1170160868 20:13308962-13308984 CTGAGATCAAGGTGCTAGCATGG - Intergenic
1170498303 20:16948392-16948414 CTGAGATCAAGGTGGTGGGAGGG - Intergenic
1170567077 20:17613461-17613483 CTGAGGTCTGGGAGGTGACAAGG + Intergenic
1170823394 20:19773041-19773063 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1170946136 20:20892486-20892508 CTGGGATCAAGGTGTTGACTGGG - Intergenic
1171133612 20:22677467-22677489 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1171330983 20:24338786-24338808 GTGAGGACATGGTGGTGGCAAGG + Intergenic
1172500118 20:35420018-35420040 CTGAAATCAAGGTGTTGACAGGG + Intergenic
1173156693 20:40619177-40619199 CTGAGGTCACGGTGTTGGCAGGG + Intergenic
1173554690 20:43957634-43957656 ATGAGATCAAGGTGTTGGCAGGG + Intronic
1174136333 20:48382628-48382650 GTGGGATCAGGGAGGTGACAGGG + Intergenic
1174177095 20:48652002-48652024 CTGAAATCATGGTGTCCACAGGG - Intronic
1174702833 20:52626274-52626296 CTGAGACCATCGTGGTGAAAGGG - Intergenic
1174983419 20:55422544-55422566 CTGAGACCATGGTTATCACAGGG + Intergenic
1175491430 20:59383383-59383405 CTGAGAGCATGGTTCTGTCAGGG - Intergenic
1175616922 20:60407607-60407629 CTGAGGACATGGTGGTGACAAGG - Intergenic
1176058634 20:63161983-63162005 CTGAAATCAAGGTGTGGACAGGG - Intergenic
1176063237 20:63181373-63181395 GTGAGATCAAGGTGGAGACCAGG - Intergenic
1176924814 21:14735274-14735296 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1177026095 21:15923503-15923525 CTGAAATCAAGGTGTTGGCAAGG - Intergenic
1177141154 21:17359597-17359619 CTGAAATCAAGTTGTTGACAGGG - Intergenic
1177351441 21:19946997-19947019 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1177788493 21:25696631-25696653 CTGAAATAAAGGTGTTGACAAGG + Intronic
1178263783 21:31124082-31124104 CTGAGAACATGGTGGCTTCACGG - Intronic
1178604727 21:34025763-34025785 CTAAAATCATGGTGTTGACAAGG - Intergenic
1178622121 21:34186162-34186184 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1178916291 21:36707362-36707384 CTGTGATCACGGTGGTGATGCGG + Intronic
1179026642 21:37684162-37684184 CTGAGATCCAGGTGTTGGCAGGG + Intronic
1179240660 21:39588275-39588297 CTGAGATCAGGGTGCTACCATGG + Intronic
1179557168 21:42187116-42187138 GTGAGATCAGGGTGGTGGCAGGG + Intergenic
1179593692 21:42428156-42428178 CAGAGATGATGGTGTTGCCAGGG - Intronic
1179599308 21:42465488-42465510 CTGAAATCATGGTGGAGCCATGG - Intergenic
1179652205 21:42818794-42818816 CTGAGATCAAGGTGCTGGCCTGG - Intergenic
1180465227 22:15604467-15604489 CAGATCTCATGGTGGTGCCAAGG + Intergenic
1180632520 22:17239537-17239559 CTGAGATCAAGGTGCTGGCAGGG - Intergenic
1180935370 22:19621978-19622000 CTGAGATCGTGGTGATTAAAAGG - Intergenic
1180975681 22:19846808-19846830 CTGAGATCAAGGTGTGGGCAGGG - Exonic
1181145393 22:20842304-20842326 CTGAAATCAAGGTGATGGCAGGG - Intronic
1181318192 22:21984829-21984851 CTCGGATCAGGGTGGTGGCAGGG - Intergenic
1181325367 22:22040640-22040662 CTGACACCATCGTGGTGACTGGG + Intergenic
1181393301 22:22599623-22599645 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1181421182 22:22800098-22800120 CTGAGATCAAGGTGTTGGCAGGG + Intronic
1181466335 22:23112563-23112585 CTGAGCTCCTGGTGGAGTCAGGG + Intronic
1181690926 22:24559869-24559891 CTGAGATCAAGGTGTTGGCAAGG + Intronic
1181895055 22:26099874-26099896 AGGAGATGATGGTGGGGACAGGG - Intergenic
1182308973 22:29391246-29391268 CTAAGATCAAGGTGTTGGCATGG + Intronic
1182743663 22:32587904-32587926 CTGAGCTCAGGGGAGTGACATGG - Intronic
1183329212 22:37210442-37210464 CTGAGATAAGGGTGGAGACAGGG - Intronic
1184976981 22:48069264-48069286 CCAAGATCATGGTGTTGGCAGGG + Intergenic
1185094276 22:48797789-48797811 CTGAGATCGAGGTGTTGGCAGGG + Intronic
949187206 3:1206449-1206471 GTGACACCCTGGTGGTGACAGGG - Intronic
949337127 3:2987058-2987080 CTGAGATCCTGAAGGTGAGAAGG + Intronic
949389314 3:3541698-3541720 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
949442357 3:4096011-4096033 ATGGGATTATGGTGGTCACAGGG + Intronic
949730344 3:7104324-7104346 CTGAGATCCTGGTGCCAACATGG - Intronic
951034808 3:17921365-17921387 GTGGGAGCATGGTGGTGATATGG + Intronic
951594377 3:24301178-24301200 TTGAAATCAAGGTGTTGACAGGG - Intronic
951911343 3:27753748-27753770 CTGAGGACATGGTGGTGAGTGGG + Intergenic
952020936 3:29019242-29019264 CTGAGACCAAGGTGTTGGCATGG - Intergenic
952191253 3:31025694-31025716 CTGAGGTCAGGGTGGTAGCAGGG - Intergenic
952258086 3:31712643-31712665 CTGAAATCAAGGTGTTGGCAGGG - Intronic
952303900 3:32128511-32128533 ATGAGATCAGGGTGTTGATAGGG + Intronic
952643271 3:35624344-35624366 CTGAGATCAAGGTGCTGGCATGG + Intergenic
952697514 3:36285706-36285728 CTGAGATCAAGGTGTTAGCAGGG - Intergenic
952952504 3:38536511-38536533 CTGAGAACAATCTGGTGACAGGG + Intronic
953853401 3:46483032-46483054 CTGAGTTCAAGCTGCTGACATGG + Intronic
954248770 3:49352502-49352524 CTGAGATGGTGGGGGTGGCATGG + Intergenic
954381420 3:50221077-50221099 CTGGGATGAGGGTGGGGACAGGG + Intergenic
954526654 3:51277832-51277854 CTGAGATGAAGGTGGTGGGATGG - Intronic
954974850 3:54683768-54683790 CTGAAATCAAGGTGTTGTCAGGG + Intronic
955128712 3:56141428-56141450 CTCACACCATGGTGGTCACAGGG - Intronic
955155412 3:56412273-56412295 CTGAAATCAAGGTGTTGGCATGG - Intronic
955497112 3:59545234-59545256 CTGAGATCAAGATGTTGGCAGGG - Intergenic
955979790 3:64513194-64513216 CCGAGATCAAGGTGCTGTCAGGG - Intergenic
956692046 3:71887600-71887622 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
956865289 3:73363296-73363318 CTTAGATCAAGGTGTTGGCAGGG + Intergenic
957152662 3:76505735-76505757 CTGAAATCAAGGTGTTGACAGGG - Intronic
957894703 3:86406940-86406962 CTAACATCAAGGTGTTGACAGGG + Intergenic
958966347 3:100563061-100563083 CTGAAATCAAGGTGTTGGCAGGG + Intronic
959267081 3:104156237-104156259 CTAAAATCAAGGTGTTGACAGGG - Intergenic
960010691 3:112831764-112831786 CCGAGATCAAGGTGTTGGCAGGG - Intronic
960063010 3:113342555-113342577 GTGAGATGATGGTGGGGAAAAGG + Intronic
960201318 3:114839905-114839927 CTGAAATCAAGGTGTTGGCAGGG - Intronic
960488465 3:118281313-118281335 ATGAGTCCATGGTGGTGATAGGG - Intergenic
960576714 3:119237294-119237316 CTGAGATCATGGGTATAACAGGG + Intronic
961345757 3:126262283-126262305 CTGAAATCAAGTTGTTGACAGGG - Intergenic
961399174 3:126623002-126623024 CTAAGATCAAGGTGTTGACAGGG - Intronic
961667502 3:128502878-128502900 CTGGGATGATGGTGGAGACCTGG + Intergenic
962056515 3:131877375-131877397 CTGGGCTCCTGGTGGTGATATGG + Intronic
962313439 3:134342238-134342260 CTGAAATCAAGGTGTTCACAGGG - Intergenic
962360148 3:134733768-134733790 CTGAGATCAAGGTCTTGGCAAGG - Intronic
962372190 3:134829975-134829997 CTGAAATCACGGTGTTGGCAGGG - Intronic
962421888 3:135236139-135236161 CTGAGATCAAGGTGTTGGCAGGG + Intronic
962533335 3:136304013-136304035 CCAAGATCATGGTGTTGGCAGGG + Intronic
963127457 3:141828338-141828360 CTGAGATCAAGGTGCTGTCTAGG + Intergenic
963195789 3:142528003-142528025 TTGAGATCAAGGTGGTGGCAGGG - Intronic
963560661 3:146860949-146860971 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
964157800 3:153606801-153606823 CTGAGAACATGATGGCCACAGGG + Intergenic
964658189 3:159091312-159091334 CCAAGATCAGGGTGCTGACACGG + Intronic
965241441 3:166204527-166204549 CAAAGATCAAGGTGGTGGCAAGG + Intergenic
965259264 3:166459339-166459361 CTGAGATCAGAGTGGTAACAGGG - Intergenic
966159176 3:176950048-176950070 CTAAGATCAAGGTGTTGGCAAGG + Intergenic
966587066 3:181638170-181638192 CTGAGATCAAGGTATTGGCAGGG + Intergenic
967180716 3:186901336-186901358 CTGAGATCAAGATGTTGGCAGGG + Intergenic
967360618 3:188626538-188626560 CTGAGATCAAGGTACTCACAAGG + Intronic
969089401 4:4682442-4682464 CTGAGATCAAGGTGTCCACAGGG + Intergenic
969145855 4:5123547-5123569 CTGAGATCAAGGTGTGGGCAGGG + Intronic
970210617 4:13706203-13706225 CTGAAATCATGGTGTTGGCAGGG + Intergenic
970297456 4:14645683-14645705 CTGAAATCAAAGTGCTGACAGGG - Intergenic
970324947 4:14913870-14913892 CTGATATCAAGGTGTTGGCAGGG + Intergenic
970329123 4:14961202-14961224 CTGAAATCAAGGTGTTGACTAGG + Intergenic
970378522 4:15482418-15482440 CTGAGATCATGGTGCCAGCATGG + Intronic
970439283 4:16066246-16066268 CTCAGGTCTTGGTGATGACATGG - Intronic
970447657 4:16137430-16137452 CTGAAATCAGTGTGTTGACAGGG + Intergenic
970706428 4:18809207-18809229 ATGAGATCTGGGTGGGGACACGG + Intergenic
971023208 4:22559885-22559907 CTGAGATCAAGATGCTAACAGGG + Intergenic
971103696 4:23498043-23498065 CTGAGATCAGGGTGTTGGTATGG - Intergenic
971211631 4:24623350-24623372 TTGAGATCAGGGTGCTGGCATGG - Intergenic
971221302 4:24709261-24709283 CTGAAATCAAGGTGTTGGCATGG - Intergenic
971323829 4:25627875-25627897 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
972426396 4:38937256-38937278 CTGAAAGCATGGTGGTATCAGGG + Intronic
972432334 4:38994991-38995013 GTGAGATCAAGGTGTTGGCACGG + Intronic
973131718 4:46655646-46655668 CTGAGATCAAGGTGTTGGGAGGG - Intergenic
973727042 4:53787244-53787266 CTGAAATCAAGGTGTTGGCAGGG + Intronic
973728165 4:53796545-53796567 CTGAGATCAAGGTGTCGGCAGGG - Intronic
973791071 4:54378701-54378723 CTGAGATCAGGGTGCAGGCATGG + Intergenic
973851485 4:54965606-54965628 CTGAGATCAGGGTGCCAACATGG - Intergenic
973940564 4:55905750-55905772 CTGAGATCATGGTGCCAGCATGG - Intergenic
973957385 4:56076238-56076260 CTGAGATCAAGGTGCCGGCAGGG - Intergenic
974083678 4:57237586-57237608 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
974124775 4:57682623-57682645 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
974856933 4:67472094-67472116 CTGAAATCAAGGTGTTGTCAAGG - Exonic
975643348 4:76523056-76523078 CTGAAATCAGGGTGGTGGCAGGG + Intronic
975661654 4:76694926-76694948 CTGAGGGCATGGAGGTGCCAGGG + Intronic
975811866 4:78178013-78178035 CTGAAATCAAGGTGTTGTCAAGG + Intronic
976666270 4:87596083-87596105 ATGTTATCATGGTGGTGAAAAGG - Intergenic
976837106 4:89387114-89387136 CTGAGATCATGATGATGTTAAGG + Intergenic
977021079 4:91760935-91760957 CTGAGATCAAGGTGTGGAAAGGG - Intergenic
977162467 4:93652295-93652317 CTGAGATCAAGGTGCTGGCAGGG - Intronic
977758332 4:100700434-100700456 CTGAAATCAAGGTGTTGATAAGG + Intronic
977987887 4:103406173-103406195 CTGAAATCAAGGTGTTGACAGGG + Intergenic
978086670 4:104663670-104663692 CTGAGATCAGGGTGTCAACATGG + Intergenic
978683170 4:111408037-111408059 CTGTGATCAAGGTGTTGGCAGGG + Intergenic
979428898 4:120602968-120602990 CTAAAATCAAGGTGTTGACAAGG + Intergenic
979533147 4:121790531-121790553 AAGAGTTCATGGTGGAGACATGG - Intergenic
979740880 4:124149419-124149441 CTGAGATCAAGGAGTTGGCAGGG + Intergenic
979797887 4:124869980-124870002 CTGAGATCAAGTTGTTGGCAGGG - Intergenic
979814520 4:125084159-125084181 CTGAGATCAGGGTGCTGATGTGG + Intergenic
979882405 4:125978026-125978048 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
980323404 4:131308238-131308260 ATGAGATCTGGGTGGGGACACGG + Intergenic
981134942 4:141200165-141200187 CTGAGATCAGGGTGCTGGCATGG + Intronic
982983789 4:162177848-162177870 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
983793632 4:171830227-171830249 CTGAAATCAAGGTGTTGGCAGGG - Intronic
983819274 4:172172623-172172645 CTAAGATCATGATGTTGAAAAGG - Intronic
983855115 4:172633676-172633698 CTGAGATCTTGGAGGGGCCAGGG + Intronic
985378879 4:189371547-189371569 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
985729224 5:1537914-1537936 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
986218257 5:5741911-5741933 CTGAAATCAAGGTGTTGACAGGG + Intergenic
986226268 5:5817399-5817421 CTGAAAATATGGTGGGGACATGG + Intergenic
986269048 5:6215875-6215897 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
986484971 5:8226904-8226926 CCAAGATCAAGGTGCTGACAGGG - Intergenic
986504024 5:8430312-8430334 CTGAGAGCACGGGGGTGCCAGGG + Intergenic
986520308 5:8608971-8608993 CAGAGATCAAGGTGTTGGCAAGG - Intergenic
986666669 5:10110372-10110394 CTGAGATCGAGATGCTGACAGGG - Intergenic
986694922 5:10343150-10343172 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
986704464 5:10443700-10443722 CTAAAATCAAGGTGTTGACAGGG + Intronic
986804211 5:11292885-11292907 CTGAGATCAAGGTGTTGGCAGGG - Intronic
986907476 5:12512694-12512716 GTGAGATTATGGTGAGGACACGG + Intergenic
987216803 5:15746003-15746025 CTGGAATCTTGGTGGTGAGAGGG + Intronic
987568548 5:19625508-19625530 CTGAAATCAAGGTGTTGGCAGGG + Intronic
988293638 5:29325075-29325097 CTGAAATCAAGATGGTGGCAGGG - Intergenic
988348227 5:30068723-30068745 CTGAGATCATGGTGCCCGCATGG + Intergenic
988483306 5:31647441-31647463 CTGAAATCAAGGTGTTGACAGGG + Intronic
988537844 5:32084891-32084913 CTGAAATCTTGGAGGTGGCAGGG - Intronic
988660187 5:33257942-33257964 CTGAGATCAAGGTGTAGGCAGGG - Intergenic
988738541 5:34046606-34046628 CTGAGATCAAGGTGTTAGCAGGG - Intronic
988840747 5:35081399-35081421 CTGACACGATGGTGGGGACATGG - Intronic
989224248 5:39007249-39007271 CTAAGATCAAGGTGTTGGCAGGG + Intronic
989255526 5:39362481-39362503 CTGAAATCAAGGTGTTGGCAGGG - Intronic
989445802 5:41526922-41526944 CTGAAATCAAGGTGTTGGCAAGG - Intergenic
990175603 5:53104528-53104550 CTGAAATCATGGTGGTGATATGG + Intronic
990597836 5:57329242-57329264 CTGAGATCAGGGTGCCAACATGG + Intergenic
990803268 5:59629582-59629604 CTGAGATCAAGGTGTTGGCAGGG - Intronic
991011201 5:61884649-61884671 ATGAGACCAAGGAGGTGACAGGG + Intergenic
991932004 5:71762644-71762666 CTGAGATCAGGGTGCTCATATGG - Intergenic
992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG + Exonic
992386219 5:76286967-76286989 ATGAGATCTGGGTGGGGACACGG + Intronic
992806626 5:80344070-80344092 CTGAGATCAAGGTGTTATCAGGG + Intergenic
992993858 5:82313391-82313413 CTAAGATTCTGGTGGTGAAAAGG - Intronic
993199240 5:84791174-84791196 CTGGGCTCATGGTGGTGCCTTGG - Intergenic
993308317 5:86296768-86296790 TTGTGTTCTTGGTGGTGACATGG - Intergenic
993820040 5:92602696-92602718 CTGAAATCAGGGTGTTGGCAGGG - Intergenic
994233926 5:97339764-97339786 CTGTGATGGTGGTGGTCACAGGG + Intergenic
994451400 5:99949512-99949534 ATGAGAACGTGGAGGTGACACGG - Intergenic
994728639 5:103465492-103465514 CTAAAACCAAGGTGGTGACACGG + Intergenic
994750473 5:103731528-103731550 CTGAGAACATGGGGATGGCAGGG - Intergenic
994798184 5:104333505-104333527 CTGAGTTCATAGTGGGAACAGGG + Intergenic
995400800 5:111738985-111739007 CTGAGATCAAGATGTTGGCAGGG - Intronic
995721300 5:115136387-115136409 CAGAGATCAAGGTGTTGGCAGGG - Intronic
996159128 5:120140492-120140514 CTCAGATAATGGTCATGACAAGG + Intergenic
996178698 5:120391988-120392010 CTGAGATCAGGGTGCTAGCATGG - Intergenic
996341860 5:122447236-122447258 CTGAGATCAAGGTGCTGGCCAGG - Intronic
996399024 5:123039769-123039791 CTGAGATCAAGGTGTTGGCAAGG - Intergenic
996534981 5:124568390-124568412 CTGATATCGAGGTGTTGACAGGG - Intergenic
996634117 5:125669725-125669747 CTGAGATTAAGGTGTTGGCAGGG - Intergenic
997181083 5:131829877-131829899 CTGAAATCAAGGTGTTGGCAGGG - Intronic
997846531 5:137291494-137291516 CTGACATCATGGTGTTTCCATGG + Intronic
997858759 5:137397124-137397146 CTGACATCATGGTGGGATCATGG - Intronic
998058568 5:139100624-139100646 GAGAGATCATGGTGATCACACGG + Intronic
998676394 5:144413301-144413323 CTGAGATCAAGGTGTCAACAAGG - Intronic
998772632 5:145563742-145563764 CTGAGAGAATGGTGGTTACCAGG + Intronic
998773237 5:145569973-145569995 CTGAGATCAAGGTGTTGGCCAGG + Intronic
998909377 5:146941876-146941898 CTGAAATCAAGGTGTTGGCAGGG + Intronic
999066079 5:148686828-148686850 CTAAGATCATGGAGCTGGCAGGG - Intergenic
999738880 5:154534227-154534249 CTGAGGTCAGAGTGGTGACAGGG + Intergenic
1000443631 5:161293588-161293610 CTGAGATGATAATGGTGTCATGG - Exonic
1000609373 5:163357833-163357855 CTGAGATCAGGGTGTTGTCAGGG - Intergenic
1001198219 5:169692753-169692775 CTGAGATTAAGGTGTTGGCAGGG + Intronic
1001535937 5:172497869-172497891 CAGAGATGAGGGGGGTGACAGGG - Intergenic
1001668789 5:173456353-173456375 CTGAGATCAATGTGTTGGCAGGG - Intergenic
1001809125 5:174613655-174613677 CTGAGATCAAGGTGTTGGTAGGG - Intergenic
1001933309 5:175687945-175687967 CTGAGATCAAGGTGTTAGCAGGG + Intergenic
1002003164 5:176210026-176210048 CTGAGATTCAGGTGGGGACATGG + Intergenic
1002223291 5:177700924-177700946 CTGAGATTCAGGTGGGGACATGG - Intergenic
1002329500 5:178431694-178431716 CTGAAATCAAGATGGTGGCAGGG - Intronic
1002329862 5:178434015-178434037 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1002335548 5:178475697-178475719 CTGAGATCTTGGTGCTGGCAGGG + Intronic
1002360715 5:178668612-178668634 CCGAGATCAAGGTGATGGCAGGG + Intergenic
1002441456 5:179266533-179266555 CTAAGATCAAGGTGCTGGCAGGG - Intronic
1003580406 6:7334970-7334992 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1003835865 6:10071932-10071954 CTGAGAACTTGGTTGTGAAAAGG + Intronic
1003976953 6:11353527-11353549 CTGAAATCAAGGTGCTGGCAGGG - Intronic
1004476888 6:15981633-15981655 CTGAAATCAGGGTGTTGGCAGGG + Intergenic
1005250975 6:23945749-23945771 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1005273056 6:24186955-24186977 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1006142857 6:31941255-31941277 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1006323415 6:33334696-33334718 CTGAGATCAAGGTGTAGGCAGGG - Intergenic
1006388013 6:33742834-33742856 CTGAGATCAGGGTGGTTTGAGGG + Intronic
1007119690 6:39369640-39369662 CAGAGAACATGCTGGTGAGAAGG - Intronic
1007200626 6:40105445-40105467 CAGACATCATGGAGTTGACAGGG + Intergenic
1007356726 6:41324646-41324668 CTGTGATCAAGGTGTTGGCAGGG - Intergenic
1007718888 6:43873679-43873701 CTGAGGTCAGGGAGGTAACAGGG + Intergenic
1008526573 6:52413235-52413257 CTGAAATCAGGGTGCTGGCAAGG - Intergenic
1008538473 6:52526029-52526051 CTGAAATCAAGATGGTGGCAGGG - Intronic
1009032707 6:58080097-58080119 CTGAAATTAAGGTGTTGACAGGG - Intergenic
1009208319 6:60831865-60831887 CTGAAATTAAGGTGTTGACAGGG - Intergenic
1009436324 6:63622461-63622483 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1009966664 6:70585487-70585509 CTGAAATCAGGGTGGTAGCATGG - Intronic
1010068982 6:71720919-71720941 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1010108968 6:72202292-72202314 CTGAGATCAGGGTGTTGGCAGGG + Intronic
1010149260 6:72711281-72711303 CCAAGATCATGGTGTTGGCAGGG - Intronic
1010327595 6:74582507-74582529 CTAAAATCAAGGTGGTGGCAGGG - Intergenic
1011796947 6:90966359-90966381 CCAAGATCAGGGTGCTGACAAGG + Intergenic
1012153487 6:95785961-95785983 CTGAGATCCAGGTGTTGGCAGGG + Intergenic
1012227358 6:96719350-96719372 CTGAAATCATGGTGTTGGTAAGG - Intergenic
1012249028 6:96959415-96959437 CTGAGATCAAGGTGTTAACAGGG + Intronic
1012262135 6:97099891-97099913 CTGTGATCATTGTGGTGAAGAGG + Intronic
1012809905 6:103944104-103944126 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1013091911 6:106907841-106907863 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1013721073 6:113028547-113028569 CTGGGCTCTTGGTGGGGACATGG - Intergenic
1013788296 6:113807537-113807559 CTGAAATCAAGTTGCTGACAGGG - Intergenic
1014220118 6:118791513-118791535 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1015138559 6:129902813-129902835 CTGAACTCATGGTGTTGTCAGGG + Intergenic
1015199863 6:130566946-130566968 GTGAGATCTGGGTGGGGACATGG + Intergenic
1015501435 6:133937448-133937470 TTGGGATCATGGTGGACACAAGG - Intergenic
1016431258 6:143988693-143988715 CTGAGATCATGGTGCCAGCATGG + Intronic
1016440253 6:144075978-144076000 CTGAGATCAAGCTGTTGCCAGGG + Intergenic
1016582219 6:145641429-145641451 CTGAGATCAAGGTGTCCACAGGG - Intronic
1016631066 6:146232241-146232263 CAGAGTTCAAGGTGTTGACAAGG + Intronic
1016692168 6:146950700-146950722 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1016918952 6:149272379-149272401 TTAAAATCAAGGTGGTGACAGGG + Intronic
1017066433 6:150533415-150533437 CCAAGATCAAGGTGTTGACAGGG - Intergenic
1017364706 6:153621674-153621696 CTGAGATCAAGATGTTGGCAGGG + Intergenic
1017373193 6:153736607-153736629 CTCAGTTCATGGTGCTGTCATGG - Intergenic
1017675698 6:156811500-156811522 CCGAGATCAAGGTGCTGGCAAGG + Intronic
1018396023 6:163378624-163378646 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1019112729 6:169729862-169729884 CTGAGATCAGGGTGCCAACATGG - Intergenic
1019423799 7:963743-963765 CTGTGAACATGGTGCTTACATGG + Intronic
1019489927 7:1307554-1307576 CGGAGTTCATGGTGGAGCCAGGG - Intergenic
1020109197 7:5438710-5438732 CTGAGATCAGGGTGTTGGCAGGG + Intronic
1020266540 7:6564302-6564324 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1020760622 7:12264162-12264184 GTGAGATTTTGGTGGGGACATGG + Intergenic
1021126370 7:16854729-16854751 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1021463493 7:20914955-20914977 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1021576724 7:22112025-22112047 CTGAGATCAAGGTGCTCGCAGGG + Intergenic
1021738570 7:23662794-23662816 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1022243047 7:28531285-28531307 CCGAGATCAAGGTGTTGGCAAGG + Intronic
1022842265 7:34175975-34175997 CCAAGATCATGGTGCTGGCAGGG + Intergenic
1023073727 7:36462844-36462866 CTGACATCATGCTGGTGGGAGGG + Intergenic
1023178144 7:37453620-37453642 CTGAGGTCAGAGTGCTGACATGG + Intergenic
1024036833 7:45513888-45513910 CTGAGATTAAGGTGTTGGCAGGG - Intergenic
1024098680 7:46006802-46006824 CTGAGATCAAGGTGTTCTCAGGG - Intergenic
1024117306 7:46206341-46206363 CTGTGATCAGGGTGGTGTGAGGG - Intergenic
1024192984 7:47031395-47031417 CTGAGAGCAAGGTGTTGTCAGGG - Intergenic
1024365058 7:48510647-48510669 CTGAGATCAAGGTGTTGGCAGGG + Intronic
1024576470 7:50768541-50768563 TTGAGAACATAGTGATGACATGG - Intronic
1024635975 7:51290804-51290826 CTGAGGTCAAGGTGTTCACATGG - Intronic
1024978459 7:55134851-55134873 CTGAGATCATGGACATGAAAGGG - Intronic
1025022860 7:55493651-55493673 CTGTGATCAGTATGGTGACAGGG - Intronic
1026289742 7:68995799-68995821 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
1026299382 7:69083867-69083889 CCAAGATCAAGGTGCTGACAGGG + Intergenic
1027440757 7:78216864-78216886 CTGAGATCAAGGTGTTGGTAGGG + Intronic
1027536657 7:79411563-79411585 CTAAAATCAAGGTGTTGACAGGG - Intronic
1027642733 7:80757265-80757287 CATAGGTCATGATGGTGACAAGG - Intronic
1027832401 7:83196222-83196244 CTAAGATCAAGGTGTTGGCAGGG - Intergenic
1027933272 7:84567848-84567870 CTGAGATCAAGTTTTTGACAGGG - Intergenic
1028367848 7:90055038-90055060 CTAAGATCAAGGTGTTGGCAAGG - Intergenic
1028502988 7:91539547-91539569 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1028512069 7:91636246-91636268 CTGAGATCAAGGTGTCGGCAAGG - Intergenic
1028603562 7:92629818-92629840 CTGAGATCAGGGTGCTAGCATGG + Intronic
1028735211 7:94203501-94203523 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1028940206 7:96513275-96513297 CTGAAATCAGGGTGCTGTCAGGG - Intronic
1029692417 7:102191100-102191122 GGGAGAGCATGGTGGGGACAGGG - Intronic
1029946522 7:104539098-104539120 CTAAAATCAAGGTGTTGACAGGG - Intronic
1030284434 7:107811315-107811337 CTAAAATCAAGGTGTTGACAGGG + Intergenic
1030287996 7:107846471-107846493 CTAAAATCAAGGTGCTGACATGG + Intergenic
1030550210 7:110948998-110949020 CTGAGAACCTGGTGGGGGCAGGG - Intronic
1030600215 7:111583837-111583859 CCAAGATCAAGGTGTTGACAGGG + Intergenic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1031817401 7:126454837-126454859 CTGAGATCAAGGTGTCAACAAGG - Intronic
1031865943 7:127039402-127039424 CTGAGATCAAGGCGTTGGCAGGG - Intronic
1031915455 7:127558852-127558874 CTAAAATCAAGGTGTTGACAGGG - Intergenic
1031978057 7:128106191-128106213 CTGAGATCAGAGTGGGGCCAGGG - Intergenic
1032123369 7:129172958-129172980 CTGAAATCAAGGTGTTGACCAGG + Intergenic
1032189394 7:129755103-129755125 CTGATATCCTGGTGGTCACAGGG - Exonic
1032440430 7:131938665-131938687 CTGAAGTCATGGTGTTGGCAGGG + Intergenic
1032449883 7:132020883-132020905 CTGAGGTCATAGTGGTGAGCAGG - Intergenic
1032718518 7:134531153-134531175 CTGAGATCACAGTGCTGAAAGGG - Intronic
1032751312 7:134844713-134844735 CTGAGATCAAAGTGTTGGCATGG + Intronic
1032879501 7:136074184-136074206 CTGAAATCAAGGTGTTCACAAGG - Intergenic
1032977045 7:137237312-137237334 CTGAGATCAAGGTATTGTCAGGG - Intronic
1033409522 7:141104682-141104704 CTGAGATCAAGGTGTTGGCAGGG + Intronic
1033579306 7:142717094-142717116 GTGAGTTCATGGTGGTGTCTCGG - Intergenic
1034637905 7:152581891-152581913 CTGAGAGCGTGGTGGTGGGATGG - Intergenic
1034816368 7:154175425-154175447 CCGAGCTCATGCTGGTGCCAGGG - Intronic
1034945586 7:155259811-155259833 CTGAGAACAGGCTGGGGACACGG - Intergenic
1034970481 7:155416225-155416247 CTGAGATCAGGGTGTGGGCAGGG + Intergenic
1035044862 7:155957090-155957112 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1035528438 8:332872-332894 CTGAAATCAGGGTGGGGACAGGG - Intergenic
1035528455 8:332917-332939 CTGAAATCAGGGTGGGAACAGGG - Intergenic
1035528471 8:332962-332984 CTGAAATCAGGGTGGAGACAGGG - Intergenic
1035860900 8:3026631-3026653 CAGAGTTCACGGTGTTGACAGGG - Intronic
1036197392 8:6731808-6731830 CCAAGATCAAGGTGTTGACAGGG + Intronic
1036198396 8:6744473-6744495 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1036504354 8:9341934-9341956 CTGAGATCAAGGTGTCGGCAGGG - Intergenic
1036814274 8:11889446-11889468 CTGAGATCAAGGTGTTGGCATGG - Intergenic
1037423691 8:18731478-18731500 CTGAGATCATGTTTGATACAGGG - Intronic
1037648150 8:20812516-20812538 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1037693521 8:21204278-21204300 CTTAAATCATGGTGTTGAAATGG - Intergenic
1037726527 8:21487005-21487027 ATGAGATCATGTGGGTGACGGGG - Intergenic
1037737674 8:21580450-21580472 CTAAGATCAAGGTGCTGGCAGGG - Intergenic
1037739133 8:21591330-21591352 CTGAGATCAGGGTGCCAACATGG + Intergenic
1037755691 8:21708826-21708848 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1037871466 8:22501421-22501443 CTGAAATCAAGGTGTTGCCAGGG + Intronic
1038464009 8:27743217-27743239 CTTAGAATATGGTGGTGACTTGG - Intronic
1038915344 8:32015025-32015047 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1038925058 8:32129305-32129327 CTGAAATCAAGGTGTTGTCAGGG + Intronic
1038962377 8:32536177-32536199 CTGAAATCAAGGTGTTGACCGGG + Intronic
1039581977 8:38674552-38674574 CTGAGATCATGGTGTTGAGAGGG + Intergenic
1040387878 8:46925866-46925888 CTGAGATCTTGGCTGGGACAGGG - Intergenic
1040484546 8:47857640-47857662 CTGAGATCAAGCTGCTGGCAGGG - Intronic
1040715581 8:50247910-50247932 CTGAGATCAAGTTGTTGGCAGGG + Intronic
1040891136 8:52317449-52317471 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1041081250 8:54216869-54216891 CTGAGATCCAGGTGTTGTCAGGG - Intergenic
1041180971 8:55247647-55247669 ATGAGATCATGAAGGTGACTCGG - Intronic
1041224709 8:55686845-55686867 CTGACATGATGGTGGTAGCATGG - Intergenic
1041260686 8:56018672-56018694 CTGAGATCAAGGTGTCGGCAGGG - Intergenic
1041519013 8:58734014-58734036 CTGAGATCAGGGTGCCGGCAGGG - Intergenic
1041644235 8:60235189-60235211 CTGAGATCAAGGTGTGGGCAGGG + Intronic
1041684161 8:60627310-60627332 CTAAAATCAAGGTGGTGGCAGGG + Intergenic
1042081757 8:65061499-65061521 CTGACATCATGGCGGGGGCAGGG - Intergenic
1042115385 8:65426081-65426103 CTGAGATGAAGGTGCTGACAGGG - Intergenic
1042456281 8:69007770-69007792 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1042786397 8:72551418-72551440 CTGAGACGATGCTGGCGACAAGG - Intronic
1043037195 8:75212976-75212998 CTGAGATCAAGGTGCTTTCAGGG + Intergenic
1043199606 8:77350158-77350180 CTAAGATCAAGGTGTTGGCATGG + Intergenic
1043327960 8:79076548-79076570 TAGATATCATGGTGGTGACTAGG + Intergenic
1043358556 8:79442059-79442081 CAGAAATCATGGTGTTGTCAGGG - Intergenic
1043392777 8:79807690-79807712 CTGAGATTAAGGTGTTGGCAGGG - Intergenic
1044281933 8:90366694-90366716 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1044356261 8:91225677-91225699 CTGAGATCATGGGGTTAAAATGG - Intronic
1044501242 8:92960776-92960798 CTGAAATCAAGGTCGGGACAGGG - Intronic
1044610666 8:94088775-94088797 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1044776899 8:95699392-95699414 CAGAGATTTTGGTGGTCACATGG + Intergenic
1045754715 8:105529080-105529102 CTGAGATCAAGGTGTAGGCAGGG + Intronic
1046442707 8:114279890-114279912 CTAATATCAAGGTGTTGACAGGG + Intergenic
1046803287 8:118452154-118452176 CTGAGATCATGGTGCCGATGTGG - Intronic
1046917775 8:119695198-119695220 CTGAGATCAAGATGGCGGCAGGG - Intergenic
1047773725 8:128051285-128051307 CTGAGAACCTGGTGCTGACTGGG + Intergenic
1047993883 8:130315194-130315216 CCCAAATCATGGTGGTGGCATGG + Intronic
1048153774 8:131921200-131921222 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1048184942 8:132231194-132231216 CTGAAATCAAGGTATTGACAGGG - Intronic
1048236349 8:132694463-132694485 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1048267560 8:133000927-133000949 CTGAGATCAAAGTGTAGACAAGG + Intronic
1048311283 8:133324231-133324253 CTGAGATCAAGATGTTGGCAGGG + Intergenic
1048402618 8:134086191-134086213 CAGAGATCCTGTGGGTGACATGG + Intergenic
1048421129 8:134279353-134279375 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1048740543 8:137554366-137554388 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1048887078 8:138917214-138917236 TTAAGATCAAGGTGGTGGCAGGG + Intergenic
1048927184 8:139281584-139281606 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1048936898 8:139364992-139365014 TTGAGATCAAGGTGTTGGCAGGG + Intergenic
1049161144 8:141098736-141098758 CTGAGGTCAGGGAGGTAACACGG - Intergenic
1049244801 8:141556591-141556613 CTGAGATCCAGGTGCTGGCAGGG + Intergenic
1049285120 8:141770547-141770569 CTGAAATCAAGGTGCTGCCAGGG - Intergenic
1050146301 9:2571657-2571679 CTGAGATTAAGATGTTGACAGGG + Intergenic
1050291698 9:4161999-4162021 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1050662562 9:7898854-7898876 CTAAAATCATGGTGTTGGCAGGG - Intergenic
1050775412 9:9253857-9253879 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1051890938 9:21942305-21942327 CTGAGATCAAGGTGCTGGTAAGG + Intronic
1051922638 9:22286041-22286063 CTGAGATCCATGTGATGACATGG + Intergenic
1053006118 9:34605795-34605817 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1053276061 9:36784215-36784237 CTGAAATCAAGGTGCTGGCAGGG + Intergenic
1054746158 9:68855996-68856018 CTAAAATCAAGGTGTTGACAAGG + Intronic
1054762588 9:69016223-69016245 CTGAGATTATGGGGGAGACGTGG - Intergenic
1055588618 9:77785359-77785381 CTGAAATCAAGGTGTTGGCAGGG - Intronic
1056083855 9:83125341-83125363 CTAAAATCAAGGTGCTGACAGGG - Intergenic
1056085834 9:83148565-83148587 CTGAGATCAAGGTCCTGGCAGGG - Intergenic
1056489098 9:87087409-87087431 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1056622099 9:88222925-88222947 CTGAGATCAAGGTGTGCACATGG - Intergenic
1056793998 9:89644400-89644422 CCGAGGATATGGTGGTGACAGGG + Intergenic
1056839412 9:89986479-89986501 CTAAGATCAAGGTGTTGGCAGGG + Intergenic
1056879705 9:90379561-90379583 CTGAAATCAAGGTGCTGGCAGGG - Intergenic
1057170015 9:92956593-92956615 CTGAGATCAAGGTGTTGGCAGGG - Intronic
1057278663 9:93694159-93694181 CTGAGATCAGGGTGCCGGCAGGG - Intergenic
1057309038 9:93930160-93930182 CTGAGATCAAGGTGTCGGCAGGG - Intergenic
1057309418 9:93932734-93932756 CTGAGATCAAGGTGTCGGCAGGG + Intergenic
1057835635 9:98442711-98442733 CTGAGATCAAGTTGTTGGCAAGG + Intronic
1058464164 9:105211695-105211717 CTGAGATCAAGGTGTCGGCAGGG + Intergenic
1058474378 9:105316979-105317001 CTGAAATCAAAGTGTTGACAGGG + Intronic
1058759263 9:108114319-108114341 CTGAGGTCATGGTGAGTACAGGG + Intergenic
1058888785 9:109343234-109343256 CTGAGTTCATGGATGTGAAACGG + Intergenic
1059108528 9:111532568-111532590 CTGAGATCTAGGTGTTGGCAGGG - Intronic
1059754557 9:117280640-117280662 CTGAAATCATGGTGTTGGCAGGG - Intronic
1059811234 9:117857895-117857917 CTGAGACCAAGGTGTTGGCAGGG + Intergenic
1059852585 9:118361195-118361217 CTGAGATCAAGTAGGGGACATGG + Intergenic
1059883665 9:118720550-118720572 CTGAGATCATAGTGCCAACATGG + Intergenic
1059915501 9:119095213-119095235 CTGAGACGAAGGTGTTGACAGGG + Intergenic
1060584813 9:124779365-124779387 CAGAGATCCCAGTGGTGACAAGG - Intronic
1060976859 9:127770187-127770209 CTGAGATCATGGGGATGAAGAGG - Intronic
1061282971 9:129607999-129608021 CCGAGATCAGGGTGCTGGCATGG + Intergenic
1061714812 9:132512109-132512131 CTGAAATCAAGGTGTTGGCAGGG + Intronic
1061944897 9:133903223-133903245 CTGAGATCAGGGTGGCGGCGGGG - Intronic
1062068468 9:134541452-134541474 CTGTCATCATGGTGGGCACAGGG - Intergenic
1062141915 9:134963930-134963952 CTGAGATCAAGGGGCTGGCAGGG + Intergenic
1185456578 X:313808-313830 CTGAGATCAAGGTGAGGACAGGG - Intronic
1185521915 X:746814-746836 CTGAGATCAAGGTGTGGACAGGG - Intergenic
1185558003 X:1036537-1036559 CTGACATCAAGGTGTGGACAGGG - Intergenic
1185663661 X:1746815-1746837 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185770311 X:2760929-2760951 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1185770443 X:2761820-2761842 CTGAGATCAAGGTGTGGGCAGGG - Intronic
1185779650 X:2833134-2833156 CTGAGATCAGGGTGTGGGCAGGG + Intronic
1185822357 X:3217776-3217798 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1185837035 X:3354470-3354492 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1185853467 X:3510586-3510608 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185895115 X:3851545-3851567 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185895364 X:3853750-3853772 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185900233 X:3889970-3889992 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185900481 X:3892174-3892196 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185905349 X:3928401-3928423 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185905597 X:3930605-3930627 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185914584 X:4021923-4021945 CTGAGATCAAGGTGTAGGCAGGG - Intergenic
1185942238 X:4334617-4334639 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1185986961 X:4845478-4845500 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1186009318 X:5111513-5111535 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1186027940 X:5334348-5334370 CTGAAAGCATGGTGTTGGCATGG - Intergenic
1186188655 X:7046390-7046412 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1186409776 X:9336523-9336545 CTGAGATCAAGTTGTTGGCAGGG - Intergenic
1186666170 X:11719891-11719913 CTGAGATGAAGGTGTTGGCAGGG - Intergenic
1186694717 X:12018190-12018212 CTAAGATAAAGGTGTTGACAAGG + Intergenic
1186987576 X:15033346-15033368 CTGAGATCATGGTGCCAGCATGG - Intergenic
1187009301 X:15264079-15264101 CTGAAATCAAGGTGTGGACAGGG + Intronic
1187390694 X:18884844-18884866 CTGAGCTCCTGGTGGTGACAGGG + Intergenic
1187630245 X:21161412-21161434 CTGAGATCAAGGTGTTAGCAGGG + Intergenic
1187675546 X:21712542-21712564 GTGAGATCTTGGTGGGGAAAGGG + Intronic
1188211789 X:27434330-27434352 CTGAAATCAAGGTGTTGATAGGG - Intergenic
1188290648 X:28383670-28383692 CTGAGATCAAGGTGTTAGCAGGG + Intergenic
1188605247 X:32020649-32020671 CTAAGATTAAGGTGATGACAGGG - Intronic
1188847913 X:35096496-35096518 CTAAGATCAGGGTGCTGTCAGGG - Intergenic
1188887563 X:35569107-35569129 CTGTGATCATGGTGCTGATGTGG + Intergenic
1189204240 X:39224086-39224108 CTCAGAGCATGGTGGTTTCAGGG + Intergenic
1189218021 X:39344214-39344236 CTGAGATCATGGTGGACAGGAGG + Intergenic
1189230294 X:39446978-39447000 CTGAGATCAAGGTGTTGCTAGGG + Intergenic
1189249218 X:39587146-39587168 CTGAGATCGAGGTGTTGGCAGGG + Intergenic
1189347595 X:40253775-40253797 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1189671358 X:43413578-43413600 CTGAGATCAGGGTGCTAGCATGG - Intergenic
1189869411 X:45366837-45366859 CTGAAATCAAGGTGTTGCCAGGG - Intergenic
1190102087 X:47529590-47529612 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1190577509 X:51855479-51855501 CTGAGATCAAGGTGCTGGCAGGG + Intronic
1192495440 X:71613911-71613933 CTAAAATCAGGGTGTTGACAGGG + Intergenic
1193652873 X:84159941-84159963 TTGAGATCAAGGTGTTGGCAGGG - Intronic
1193728671 X:85075964-85075986 CTGAGATCAGGGTGCCAACATGG + Intronic
1193954590 X:87844201-87844223 CTGCTTTCATGGAGGTGACAGGG + Intergenic
1194560164 X:95410678-95410700 CTAAGATCTGGGTGGGGACATGG - Intergenic
1194786019 X:98085221-98085243 CTCAGAGCATGGTGGTCTCAGGG + Intergenic
1195209965 X:102645407-102645429 TTGAGATTTTGGTGGGGACATGG + Intergenic
1195227854 X:102817038-102817060 CTGAGATCTTGCTGGAGACAGGG + Intergenic
1195253965 X:103075861-103075883 CAGAGATCCTGGGGGTAACAGGG + Exonic
1196027324 X:111054789-111054811 CTGAGGTGATGGTGGAGGCAGGG - Intronic
1196616718 X:117774934-117774956 CTGAGGTCATGGTATTGTCATGG - Intergenic
1196640127 X:118049941-118049963 GTGACCACATGGTGGTGACATGG - Intronic
1197379093 X:125716189-125716211 CTGAGATCAAGGTGTTGGCAGGG - Intergenic
1197685970 X:129440082-129440104 CTGAGATCATGTCAGTGTCAGGG - Intergenic
1197895317 X:131306826-131306848 CTAAGATCAAGGTGCTGGCATGG - Intronic
1198402998 X:136285710-136285732 CTGAAATCAAGGTGTTGGCAGGG + Intergenic
1198794661 X:140382829-140382851 CTGAGATCATGGTGCCAGCATGG + Intergenic
1198817099 X:140603300-140603322 CTGAGATCAAGGTGTTGGCAGGG + Intergenic
1199571514 X:149271471-149271493 ATGAGATTTTGGTGGGGACACGG + Intergenic
1199573618 X:149291880-149291902 CTGAGATCAAGGTGTTTGCAGGG + Intergenic
1199676994 X:150197383-150197405 CTGAGATCCAGGTGTTGGCAGGG - Intergenic
1199692450 X:150318872-150318894 CTGAAATCAAGGTGTTGGCAGGG - Intergenic
1199695135 X:150338637-150338659 CTGAGGTCATGGTGCTGCCCTGG - Intergenic
1199754876 X:150854753-150854775 CTGAGGTCAAGGTGTTGGCAGGG - Intronic
1199755799 X:150863978-150864000 CTGAGATCAAGGTGTTGGGAGGG - Intronic
1199845745 X:151692060-151692082 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1199848343 X:151707634-151707656 CTGAGGTCAAGGTGCTGGCAGGG + Intergenic
1199856809 X:151765967-151765989 CTGGGATCATAGTGATGGCAGGG - Intergenic
1199935938 X:152573704-152573726 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1199936175 X:152575770-152575792 CTGAGATCAAGGTGGCAGCAAGG + Intergenic
1200764539 Y:7069418-7069440 CTGAGATCAAGGTGAGGGCAGGG + Intronic
1200809933 Y:7473707-7473729 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1201239530 Y:11945280-11945302 CTGAGATCAAGGTGTGGGCAGGG - Intergenic
1201256605 Y:12113757-12113779 CTGAGATCAAGGTGTGGGCAAGG - Intergenic
1201290391 Y:12416859-12416881 CTGAGATCAGGGTGTGGGCAGGG - Intergenic
1201299947 Y:12496798-12496820 CTGAGATCAAGGTGTGGGCAGGG + Intergenic
1201474667 Y:14367267-14367289 CTGAGATCAAGGTGTGGACAGGG - Intergenic
1201479527 Y:14424863-14424885 GTGAGATCCTGGTCATGACAGGG + Intergenic
1202479728 Y:25299120-25299142 GTGAGATCAAGGTGTTGGCAGGG + Intergenic