ID: 1099757785

View in Genome Browser
Species Human (GRCh38)
Location 12:86876891-86876913
Sequence AGGGAGAGCGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099757785_1099757794 27 Left 1099757785 12:86876891-86876913 CCCACAGTCACTGCGCTCTCCCT No data
Right 1099757794 12:86876941-86876963 GTGCCACATGACTACTCCTGGGG No data
1099757785_1099757792 25 Left 1099757785 12:86876891-86876913 CCCACAGTCACTGCGCTCTCCCT No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757785_1099757793 26 Left 1099757785 12:86876891-86876913 CCCACAGTCACTGCGCTCTCCCT No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099757785 Original CRISPR AGGGAGAGCGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr