ID: 1099757792

View in Genome Browser
Species Human (GRCh38)
Location 12:86876939-86876961
Sequence CTGTGCCACATGACTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099757787_1099757792 6 Left 1099757787 12:86876910-86876932 CCCTCCTCCAAGCACACAGATTT No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757788_1099757792 5 Left 1099757788 12:86876911-86876933 CCTCCTCCAAGCACACAGATTTA No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757786_1099757792 24 Left 1099757786 12:86876892-86876914 CCACAGTCACTGCGCTCTCCCTC No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757785_1099757792 25 Left 1099757785 12:86876891-86876913 CCCACAGTCACTGCGCTCTCCCT No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757790_1099757792 -1 Left 1099757790 12:86876917-86876939 CCAAGCACACAGATTTACCTCTC No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data
1099757789_1099757792 2 Left 1099757789 12:86876914-86876936 CCTCCAAGCACACAGATTTACCT No data
Right 1099757792 12:86876939-86876961 CTGTGCCACATGACTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099757792 Original CRISPR CTGTGCCACATGACTACTCC TGG Intergenic
No off target data available for this crispr