ID: 1099757793

View in Genome Browser
Species Human (GRCh38)
Location 12:86876940-86876962
Sequence TGTGCCACATGACTACTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099757788_1099757793 6 Left 1099757788 12:86876911-86876933 CCTCCTCCAAGCACACAGATTTA No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data
1099757790_1099757793 0 Left 1099757790 12:86876917-86876939 CCAAGCACACAGATTTACCTCTC No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data
1099757785_1099757793 26 Left 1099757785 12:86876891-86876913 CCCACAGTCACTGCGCTCTCCCT No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data
1099757787_1099757793 7 Left 1099757787 12:86876910-86876932 CCCTCCTCCAAGCACACAGATTT No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data
1099757789_1099757793 3 Left 1099757789 12:86876914-86876936 CCTCCAAGCACACAGATTTACCT No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data
1099757786_1099757793 25 Left 1099757786 12:86876892-86876914 CCACAGTCACTGCGCTCTCCCTC No data
Right 1099757793 12:86876940-86876962 TGTGCCACATGACTACTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099757793 Original CRISPR TGTGCCACATGACTACTCCT GGG Intergenic
No off target data available for this crispr