ID: 1099758509

View in Genome Browser
Species Human (GRCh38)
Location 12:86887744-86887766
Sequence TTACCTCAGCTGACTTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099758509_1099758511 0 Left 1099758509 12:86887744-86887766 CCTTAGAAAGTCAGCTGAGGTAA No data
Right 1099758511 12:86887767-86887789 TGAGGTTAAGACATAATAAGAGG No data
1099758509_1099758512 7 Left 1099758509 12:86887744-86887766 CCTTAGAAAGTCAGCTGAGGTAA No data
Right 1099758512 12:86887774-86887796 AAGACATAATAAGAGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099758509 Original CRISPR TTACCTCAGCTGACTTTCTA AGG (reversed) Intergenic
No off target data available for this crispr