ID: 1099758825

View in Genome Browser
Species Human (GRCh38)
Location 12:86892665-86892687
Sequence CCTCACCTGGTGAAGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099758825_1099758833 28 Left 1099758825 12:86892665-86892687 CCACTCTTCTTCACCAGGTGAGG No data
Right 1099758833 12:86892716-86892738 CTGCCCCGACCTGGGCTCTGTGG No data
1099758825_1099758830 19 Left 1099758825 12:86892665-86892687 CCACTCTTCTTCACCAGGTGAGG No data
Right 1099758830 12:86892707-86892729 GCAGTGAACCTGCCCCGACCTGG No data
1099758825_1099758831 20 Left 1099758825 12:86892665-86892687 CCACTCTTCTTCACCAGGTGAGG No data
Right 1099758831 12:86892708-86892730 CAGTGAACCTGCCCCGACCTGGG No data
1099758825_1099758834 29 Left 1099758825 12:86892665-86892687 CCACTCTTCTTCACCAGGTGAGG No data
Right 1099758834 12:86892717-86892739 TGCCCCGACCTGGGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099758825 Original CRISPR CCTCACCTGGTGAAGAAGAG TGG (reversed) Intergenic
No off target data available for this crispr