ID: 1099758988

View in Genome Browser
Species Human (GRCh38)
Location 12:86893730-86893752
Sequence ACAATGGGGTTGAGAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099758988_1099758994 14 Left 1099758988 12:86893730-86893752 CCTGTGGCTCTCAACCCCATTGT No data
Right 1099758994 12:86893767-86893789 CTATAGTCTGCCTCTGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099758988 Original CRISPR ACAATGGGGTTGAGAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr