ID: 1099769705

View in Genome Browser
Species Human (GRCh38)
Location 12:87035276-87035298
Sequence GAGAGGAAATAGAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099769700_1099769705 27 Left 1099769700 12:87035226-87035248 CCTATAGCTGTAACTACTTAAAA No data
Right 1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099769705 Original CRISPR GAGAGGAAATAGAGGGATGG AGG Intergenic
No off target data available for this crispr