ID: 1099781902

View in Genome Browser
Species Human (GRCh38)
Location 12:87205911-87205933
Sequence TGTCCAATGTTGAAGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099781902_1099781906 4 Left 1099781902 12:87205911-87205933 CCTCCTACCTTCAACATTGGACA No data
Right 1099781906 12:87205938-87205960 ATTAGACAGAAAATCAACAAGGG No data
1099781902_1099781907 12 Left 1099781902 12:87205911-87205933 CCTCCTACCTTCAACATTGGACA No data
Right 1099781907 12:87205946-87205968 GAAAATCAACAAGGGAACATTGG No data
1099781902_1099781905 3 Left 1099781902 12:87205911-87205933 CCTCCTACCTTCAACATTGGACA No data
Right 1099781905 12:87205937-87205959 CATTAGACAGAAAATCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099781902 Original CRISPR TGTCCAATGTTGAAGGTAGG AGG (reversed) Intergenic
No off target data available for this crispr