ID: 1099781906

View in Genome Browser
Species Human (GRCh38)
Location 12:87205938-87205960
Sequence ATTAGACAGAAAATCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099781904_1099781906 -3 Left 1099781904 12:87205918-87205940 CCTTCAACATTGGACAGATCATT No data
Right 1099781906 12:87205938-87205960 ATTAGACAGAAAATCAACAAGGG No data
1099781902_1099781906 4 Left 1099781902 12:87205911-87205933 CCTCCTACCTTCAACATTGGACA No data
Right 1099781906 12:87205938-87205960 ATTAGACAGAAAATCAACAAGGG No data
1099781903_1099781906 1 Left 1099781903 12:87205914-87205936 CCTACCTTCAACATTGGACAGAT No data
Right 1099781906 12:87205938-87205960 ATTAGACAGAAAATCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099781906 Original CRISPR ATTAGACAGAAAATCAACAA GGG Intergenic
No off target data available for this crispr