ID: 1099785022

View in Genome Browser
Species Human (GRCh38)
Location 12:87251126-87251148
Sequence CCCAAGTTTCCAGACATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099785018_1099785022 -10 Left 1099785018 12:87251113-87251135 CCTCTCTTTCCTTCCCAAGTTTC No data
Right 1099785022 12:87251126-87251148 CCCAAGTTTCCAGACATGAAGGG No data
1099785017_1099785022 -6 Left 1099785017 12:87251109-87251131 CCTTCCTCTCTTTCCTTCCCAAG No data
Right 1099785022 12:87251126-87251148 CCCAAGTTTCCAGACATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099785022 Original CRISPR CCCAAGTTTCCAGACATGAA GGG Intergenic
No off target data available for this crispr