ID: 1099787164

View in Genome Browser
Species Human (GRCh38)
Location 12:87280517-87280539
Sequence CTAAGACACTCGCAAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099787164_1099787173 20 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787173 12:87280560-87280582 GTTGGAAGTAAGGGGCTTATAGG No data
1099787164_1099787169 2 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787169 12:87280542-87280564 GGAACTTAGAAGAAGGAAGTTGG No data
1099787164_1099787170 10 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787170 12:87280550-87280572 GAAGAAGGAAGTTGGAAGTAAGG No data
1099787164_1099787175 22 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787175 12:87280562-87280584 TGGAAGTAAGGGGCTTATAGGGG No data
1099787164_1099787171 11 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787171 12:87280551-87280573 AAGAAGGAAGTTGGAAGTAAGGG No data
1099787164_1099787174 21 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787174 12:87280561-87280583 TTGGAAGTAAGGGGCTTATAGGG No data
1099787164_1099787168 -5 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787168 12:87280535-87280557 CTTAGAAGGAACTTAGAAGAAGG No data
1099787164_1099787172 12 Left 1099787164 12:87280517-87280539 CCACCACCTTGCGAGTGTCTTAG No data
Right 1099787172 12:87280552-87280574 AGAAGGAAGTTGGAAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099787164 Original CRISPR CTAAGACACTCGCAAGGTGG TGG (reversed) Intergenic
No off target data available for this crispr