ID: 1099799190

View in Genome Browser
Species Human (GRCh38)
Location 12:87435728-87435750
Sequence TTACTTTGTTGAGTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099799190_1099799191 -3 Left 1099799190 12:87435728-87435750 CCAGCACTCACTCAACAAAGTAA No data
Right 1099799191 12:87435748-87435770 TAAACGACCATAGATTCCTCTGG No data
1099799190_1099799192 -2 Left 1099799190 12:87435728-87435750 CCAGCACTCACTCAACAAAGTAA No data
Right 1099799192 12:87435749-87435771 AAACGACCATAGATTCCTCTGGG No data
1099799190_1099799193 -1 Left 1099799190 12:87435728-87435750 CCAGCACTCACTCAACAAAGTAA No data
Right 1099799193 12:87435750-87435772 AACGACCATAGATTCCTCTGGGG No data
1099799190_1099799195 11 Left 1099799190 12:87435728-87435750 CCAGCACTCACTCAACAAAGTAA No data
Right 1099799195 12:87435762-87435784 TTCCTCTGGGGAAGTACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099799190 Original CRISPR TTACTTTGTTGAGTGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr