ID: 1099807831

View in Genome Browser
Species Human (GRCh38)
Location 12:87542812-87542834
Sequence AGGCAGAGCACAGCGACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099807822_1099807831 23 Left 1099807822 12:87542766-87542788 CCAGCAGCATCCATGTTGTACAG No data
Right 1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG No data
1099807821_1099807831 24 Left 1099807821 12:87542765-87542787 CCCAGCAGCATCCATGTTGTACA No data
Right 1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG No data
1099807826_1099807831 13 Left 1099807826 12:87542776-87542798 CCATGTTGTACAGGAGGGAATCA No data
Right 1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099807831 Original CRISPR AGGCAGAGCACAGCGACTGT AGG Intergenic
No off target data available for this crispr