ID: 1099812333

View in Genome Browser
Species Human (GRCh38)
Location 12:87599620-87599642
Sequence TTCGTCAATTGACTGTTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099812333_1099812334 -1 Left 1099812333 12:87599620-87599642 CCGAGTAACAGTCAATTGACGAA No data
Right 1099812334 12:87599642-87599664 AGTCAAGTTCAAAGTCCCTAAGG No data
1099812333_1099812335 9 Left 1099812333 12:87599620-87599642 CCGAGTAACAGTCAATTGACGAA No data
Right 1099812335 12:87599652-87599674 AAAGTCCCTAAGGTCAGAGCAGG No data
1099812333_1099812338 28 Left 1099812333 12:87599620-87599642 CCGAGTAACAGTCAATTGACGAA No data
Right 1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099812333 Original CRISPR TTCGTCAATTGACTGTTACT CGG (reversed) Intergenic
No off target data available for this crispr