ID: 1099812337

View in Genome Browser
Species Human (GRCh38)
Location 12:87599658-87599680
Sequence CTTGTTCCTGCTCTGACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099812337_1099812338 -10 Left 1099812337 12:87599658-87599680 CCTAAGGTCAGAGCAGGAACAAG No data
Right 1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG No data
1099812337_1099812339 -2 Left 1099812337 12:87599658-87599680 CCTAAGGTCAGAGCAGGAACAAG No data
Right 1099812339 12:87599679-87599701 AGCTGCAGTGATAGGAGCAGAGG No data
1099812337_1099812340 9 Left 1099812337 12:87599658-87599680 CCTAAGGTCAGAGCAGGAACAAG No data
Right 1099812340 12:87599690-87599712 TAGGAGCAGAGGTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099812337 Original CRISPR CTTGTTCCTGCTCTGACCTT AGG (reversed) Intergenic
No off target data available for this crispr