ID: 1099812338

View in Genome Browser
Species Human (GRCh38)
Location 12:87599671-87599693
Sequence CAGGAACAAGCTGCAGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099812336_1099812338 -9 Left 1099812336 12:87599657-87599679 CCCTAAGGTCAGAGCAGGAACAA No data
Right 1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG No data
1099812337_1099812338 -10 Left 1099812337 12:87599658-87599680 CCTAAGGTCAGAGCAGGAACAAG No data
Right 1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG No data
1099812333_1099812338 28 Left 1099812333 12:87599620-87599642 CCGAGTAACAGTCAATTGACGAA No data
Right 1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099812338 Original CRISPR CAGGAACAAGCTGCAGTGAT AGG Intergenic
No off target data available for this crispr