ID: 1099812339

View in Genome Browser
Species Human (GRCh38)
Location 12:87599679-87599701
Sequence AGCTGCAGTGATAGGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099812336_1099812339 -1 Left 1099812336 12:87599657-87599679 CCCTAAGGTCAGAGCAGGAACAA No data
Right 1099812339 12:87599679-87599701 AGCTGCAGTGATAGGAGCAGAGG No data
1099812337_1099812339 -2 Left 1099812337 12:87599658-87599680 CCTAAGGTCAGAGCAGGAACAAG No data
Right 1099812339 12:87599679-87599701 AGCTGCAGTGATAGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099812339 Original CRISPR AGCTGCAGTGATAGGAGCAG AGG Intergenic
No off target data available for this crispr